Postfix to Infix program that needs fixing - java

I need help with this program because it is not compiling correctly.
The program is supposed to do this:
java PostfixToInfix
1 2 3 + *
1*(2+3)
I am getting these errors when compiling:
PostfixToInfix.java:64: error: bad operand types for binary operator '-'
s.push(o2 - o1);
^
first type: String
second type: String
PostfixToInfix.java:68: error: bad operand types for binary operator '*'
s.push(o1 * o2);
^
first type: String
second type: String
2 errors
How many I supposed to code this so that it works properly? I am unsure what is wrong with my code that it is not allowing it do the functions properly.
This is my code:
import java.util.Scanner;
import java.util.Stack;
public class PostfixToInfix
{
public static void main(String[] args)
{
String[] input = readExpr();
if(checkSyntax(input) == true)
{
int k = 0;
Stack<String> s = new Stack<>();
for(int i = 0; i < input.length; ++i)
{
if(isOperator(input[i]))
{
String o1;
String o2;
if(!(s.empty()))
{
o1 = s.pop();
}
else
{
for(int j = 0; j < i; ++j)
{
k += input[j].length() + 1;
}
System.out.println("Too few operands for " + input[i]);
writeExpr(input);
for(int l = 0; l < k; ++l)
{
System.out.print(" ");
}
System.out.println("^");
return;
}
if(!(s.empty()))
{
o2 = s.pop();
}
else
{
for(int j = 0; j < i; ++j)
{
k += input[j].length() + 1;
}
System.out.println("Too few operands for " + input[i]);
writeExpr(input);
for(int l = 0; l < k; ++l)
{
System.out.print(" ");
}
System.out.println("^");
return;
}
if(input[i].equals("+"))
{
s.push(o1 + o2);
}
else if(input[i].equals("-"))
{
s.push(o2 - o1);
}
else
{
s.push(o1 * o2);
}
}
else
{
s.push(input[i]);
}
}
String Result = s.pop();
if(!(s.empty()))
{
System.out.println("Too few operators to produce a single result");
}
else
{
System.out.println(Result);
}
}
} // end main
static String[] readExpr()
{
Scanner stdin = new Scanner(System.in);
String s = stdin.nextLine();
String[] sA = s.split(" ");
return sA;
}
static void writeExpr(String[] expr)
{
for(int i = 0; i < expr.length; ++i)
{
System.out.print(expr[i] + " ");
}
System.out.println();
}
static boolean isOperator(String s)
{
if(s.equals("+") || s.equals("-") || s.equals("*"))
{
return true;
}
return false;
}
static boolean checkSyntax(String[] expr)
{
int k = 0;
for(int i = 0; i < expr.length; ++i)
{
if(!(isOperator(expr[i])))
{
try
{
Double.parseDouble(expr[i]);
}
catch (Exception e)
{
for(int j = 0; j < i; ++j)
{
k += expr[j].length() + 1;
}
writeExpr(expr);
for(int l = 0; l < k; ++l)
{
System.out.print(" ");
}
System.out.println("^");
System.out.println("Not a number or valid operator");
return false;
}
}
}
return true;
}
} // end Postfix2
class StringStack
{
int top;
String[] pancake;
StringStack() //constructor for a new empty stack
{
top = 0;
pancake = new String[1000];
} // end DoubleStack
boolean empty() //whether the stack is empty
{
return top == 0;
} // end empty
String pop() //remove and return the top element; throw an error if empty
{
if(empty())
{
throw new Error("Error");
}
top -= 1;
return pancake[top];
} // end pop
void push(String x) //add x to the top of the stack
{
if(top < 1000)
{
pancake[top] = x;
top += 1;
}
else{
throw new Error("Error");
}
} // end push
} // end StringStack

Change you code like this.
if(input[i].equals("+"))
{
s.push(o1 + "+" + o2);
}
else if(input[i].equals("-"))
{
s.push(o2 + "-" + o1);
}
else
{
s.push(o1 + "*" + o2);
}
But the result for "1 2 3 + *" is "3+2*1".
It is another problem.

Related

Binary heap output not as expected

I have a homework that the teacher test if it's corrects by checking it's output using this website moodle.caseine.org, so to test my code the program execute these lines and compare the output with the expected one, this is the test :
Tas t = new Tas();
Random r = new Random(123);
for(int i =0; i<10000;i++)t.inser(r.nextInt());
for(int i =0;i<10000;i++)System.out.println(t.supprMax());
System.out.println(t);
And my Heap (Tas) class:
package td1;
import java.util.ArrayList;
import java.util.List;
public class Tas {
private List<Integer> t;
public Tas() {
t = new ArrayList<>();
}
public Tas(ArrayList<Integer> tab) {
t = new ArrayList<Integer>(tab);
}
public static int getFilsGauche(int i) {
return 2 * i + 1;
}
public static int getFilsDroit(int i) {
return 2 * i + 2;
}
public static int getParent(int i) {
return (i - 1) / 2;
}
public boolean estVide() {
return t.isEmpty();
}
#Override
public String toString() {
String str = "";
int size = t.size();
if (size > 0) {
str += "[" + t.get(0);
str += toString(0);
str += "]";
}
return str;
}
public boolean testTas() {
int size = t.size();
int check = 0;
if (size > 0) {
for (int i = 0; i < t.size(); i++) {
if (getFilsGauche(i) < size) {
if (t.get(i) < t.get(getFilsGauche(i))) {
check++;
}
}
if (getFilsDroit(i) < size) {
if (t.get(i) < t.get(getFilsDroit(i))) {
check++;
}
}
}
}
return check == 0;
}
public String toString(int i) {
String str = "";
int size = t.size();
if (getFilsGauche(i) < size) {
str += "[";
str += t.get(getFilsGauche(i));
str += toString(getFilsGauche(i));
str += "]";
}
if (getFilsDroit(i) < size) {
str += "[";
str += t.get(getFilsDroit(i));
str += toString(getFilsDroit(i));
str += "]";
}
return str;
}
//insert value and sort
public void inser(int value) {
t.add(value);
int index = t.size() - 1;
if (index > 0) {
inserCheck(index); // O(log n)
}
}
public void inserCheck(int i) {
int temp = 0;
int parent = getParent(i);
if (parent >= 0 && t.get(i) > t.get(parent)) {
temp = t.get(parent);
t.set(parent, t.get(i));
t.set(i, temp);
inserCheck(parent);
}
}
//switch position of last element is list with first (deletes first and return it)
public int supprMax() {
int size = t.size();
int max = 0;
if (size > 0) {
max = t.get(0);
t.set(0, t.get(size - 1));
t.remove(size - 1);
supprMax(0);
}
else {
throw new IllegalStateException();
}
return max;
}
public void supprMax(int i) {
int size = t.size();
int temp = 0;
int index = i;
if (getFilsGauche(i) < size && t.get(getFilsGauche(i)) > t.get(index)) {
index = getFilsGauche(i);
}
if (getFilsDroit(i) < size && t.get(getFilsDroit(i)) > t.get(index)) {
index = getFilsDroit(i);
}
if (index != i) {
temp = t.get(index);
t.set(index, t.get(i));
t.set(i, temp);
supprMax(index);
}
}
public static void tri(int[] tab) {
Tas tas = new Tas();
for (int i = 0; i < tab.length; i++) {
tas.inser(tab[i]);
}
for (int i = 0; i < tab.length; i++) {
tab[i] = tas.supprMax();
}
}
}
The last 3 lines of the test are :
-2145024521
-2147061786
-2145666206
But the last 3 of my code are :
-2145024521
-2145666206
-2147061786
The problem are probably with the inser and supprMax methods.
I hate to get a bad grade just because of 3 lines placement, because it is a program that verify the code, it dosn't care the the solution was close, it's still says it's wrong.

PALIN- The next Palindrome - a SPOJ problem

I have opened an account for Ridit, one of 7-years-old students learning Java at SPOJ. The first task i gave to him was PALIN -The Next Palindrome. Here is the link to this problem- PALIN- The next Palindrome- SPOJAfter i explained it to him, he was able to solve it mostly except removing the leading zeros, which i did. Following is his solution of the problem -
import java.util.Scanner;
public class Main {
public static void main(String[] args) {
// TODO Auto-generated method stub
try {
Scanner in = new Scanner(System.in);
int t = Integer.parseInt(in.nextLine());
String[] numbersInString = new String[t];
for (int i = 0; i <t; i++) {
String str = in.nextLine();
numbersInString[i] = removeLeadingZeros(str);
}
for (int i = 0 ; i<t; i++) {
int K = Integer.parseInt(numbersInString[i]);
int answer = findTheNextPalindrome(K);
System.out.println(answer);
}
}catch(Exception e) {
return;
}
}
static boolean isPalindrome(int x) {
String str = Integer.toString(x);
int length = str.length();
StringBuffer strBuff = new StringBuffer();
for(int i = length - 1;i>=0;i--) {
char ch = str.charAt(i);
strBuff.append(ch);
}
String str1 = strBuff.toString();
if(str.equals(str1)) {
return true;
}
return false;
}
static int findTheNextPalindrome(int K) {
for(int i = K+1;i<9999999; i++) {
if(isPalindrome(i) == true) {
return i;
}
}
return -1;
}
static String removeLeadingZeros(String str) {
String retString = str;
if(str.charAt(0) != '0') {
return retString;
}
return removeLeadingZeros(str.substring(1));
}
}
It is giving correct answer in Eclipse on his computer, but it is failing in SPOJ. If someone helps this little boy in his first submission, it will definitely make him very happy. I couldn't find any problem with this solution... Thank you in advance...
This might be helpful
import java.io.IOException;
import java.util.Scanner;
public class ThenNextPallindrom2 {
public static void main(String[] args) throws IOException {
// TODO Auto-generated method stub
int t = 0;
Scanner sc = new Scanner(System.in);
if(sc.hasNextInt()) {
t = sc.nextInt();
}
sc.nextLine();
int[] arr, arr2;
while(t > 0) {
t--;
String s = sc.nextLine();
arr = getStringToNumArray(s);
if(all9(arr)) {
arr2 = new int[arr.length + 1];
arr2[0] = 1;
for(int i=0;i<arr.length;i++) {
arr2[i+1] = 0;
}
arr2[arr2.length -1] = 1;
arr = arr2;
} else{
int mid = arr.length/ 2;
int left = mid-1;
int right = arr.length % 2 == 1 ? mid + 1 : mid;
boolean left_small = false;
while(left >= 0 && arr[left] == arr[right]) {
left--;
right++;
}
if(left < 0 || arr[left] < arr[right]) left_small = true;
if(!left_small) {
while(left >= 0) {
arr[right++] = arr[left--];
}
} else {
mid = arr.length/ 2;
left = mid-1;
int carry = 1;
if(arr.length % 2 == 0) {
right = mid;
} else {
arr[mid] += carry;
carry = arr[mid]/10;
arr[mid] %= 10;
right = mid + 1;
}
while(left >= 0) {
arr[left] += carry;
carry = arr[left] / 10;
arr[left] %= 10;
arr[right++] = arr[left--];
}
}
}
printArray(arr);
}
}
public static boolean all9(int[] arr) {
for(int i=0;i<arr.length;i++) {
if(arr[i] != 9)return false;
}
return true;
}
public static void printArray(int[] arr) {
for(int i=0;i<arr.length;i++) {
System.out.print(arr[i]);
}
System.out.println();
}
public static int[] getStringToNumArray(String s) {
int[] arr = new int[s.length()];
for(int i=0; i<s.length();i++) {
arr[i] = Integer.parseInt(String.valueOf(s.charAt(i)));
}
return arr;
}
}

illegal start of expression in java while declaring private variables in public class

import java.util.InputMismatchException;
import java.util.Scanner;
import java.util.Stack;
public class TSPNearestNeighbour {
{
private final Stack<Integer> stack;
private int numberOfNodes;
public TSPNearestNeighbour()
{
stack = new Stack<Integer>();
}
public void tsp(int adjacencyMatrix[][])
{
numberOfNodes = adjacencyMatrix[1].length - 1;
int[] visited = new int[numberOfNodes + 1];
visited[1] = 1;
stack.push(1);
int element, dst = 0, i,cost=0;
int min = Integer.MAX_VALUE;
boolean minFlag = false;
System.out.print(1 + "\t");
while (!stack.isEmpty())
{
element = stack.peek();
i = 1;
min = Integer.MAX_VALUE;
while (i <= numberOfNodes)
{
if (adjacencyMatrix[element][i] > 1 && visited[i] == 0)
{
if (min > adjacencyMatrix[element][i])
{
min = adjacencyMatrix[element][i];
cost=cost+adjacencyMatrix[element][i];
dst = i;
minFlag = true;
}
}
i++;
}
if (minFlag)
{
visited[dst] = 1;
stack.push(dst);
System.out.print( dst + "\t");
minFlag = false;
continue;
}
stack.pop();
}
System.out.println("total cost" +cost);
}
public static void main(String args[])
{
int number_of_nodes;
Scanner scanner = null;
try
{
System.out.println("Enter the number of nodes in the graph");
scanner = new Scanner(System.in);
number_of_nodes = scanner.nextInt();
int adjacency_matrix[][] = new int[number_of_nodes + 1][number_of_nodes + 1];
System.out.println("Enter the adjacency matrix");
for (int i = 1; i <= number_of_nodes; i++)
{
for (int j = 1; j <= number_of_nodes; j++)
{
adjacency_matrix[i][j] = scanner.nextInt();
}
}
for (int i = 1; i <= number_of_nodes; i++)
{
for (int j = 1; j <= number_of_nodes; j++)
{
if (adjacency_matrix[i][j] == 1 && adjacency_matrix[j][i] == 0)
{
adjacency_matrix[j][i] = 1;
}
}
}
System.out.println("the citys are visited as follows");
TSPNearestNeighbour tspNearestNeighbour = new TSPNearestNeighbour();
tspNearestNeighbour.tsp(adjacency_matrix);
} catch (InputMismatchException inputMismatch)
{
System.out.println("Wrong Input format");
}
scanner.close();
}
}
> illegal start of expression in the line:
> **private final Stack<Integer> stack;**
You have 2 open braces
public class TSPNearestNeighbour { {
remove one and may be you get your code compiled

finding a supersequence of DNA Java

I am struggling with a "find supersequence" algorithm.
The input is for set of strings
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
the result would be properly aligned set of strings (and next step should be merge)
String E = "ca ag cca cc ta cat c a";
String F = "c gag ccat ccgtaaa g tt g";
String G = " aga acc tgc taaatgc t a ga";
Thank you for any advice (I am sitting on this task for more than a day)
after merge the superstring would be
cagagaccatgccgtaaatgcattacga
The definition of supersequence in "this case" would be something like
The string R is contained in supersequence S if and only if all characters in a string R are present in supersequence S in the order in which they occur in the input sequence R.
The "solution" i tried (and again its the wrong way of doing it) is:
public class Solution4
{
static boolean[][] map = null;
static int size = 0;
public static void main(String[] args)
{
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
Stack data = new Stack();
data.push(A);
data.push(B);
data.push(C);
Stack clone1 = data.clone();
Stack clone2 = data.clone();
int length = 26;
size = max_size(data);
System.out.println(size+" "+length);
map = new boolean[26][size];
char[] result = new char[size];
HashSet<String> chunks = new HashSet<String>();
while(!clone1.isEmpty())
{
String a = clone1.pop();
char[] residue = make_residue(a);
System.out.println("---");
System.out.println("OLD : "+a);
System.out.println("RESIDUE : "+String.valueOf(residue));
String[] r = String.valueOf(residue).split(" ");
for(int i=0; i<r.length; i++)
{
if(r[i].equals(" ")) continue;
//chunks.add(spaces.substring(0,i)+r[i]);
chunks.add(r[i]);
}
}
for(String chunk : chunks)
{
System.out.println("CHUNK : "+chunk);
}
}
static char[] make_residue(String candidate)
{
char[] result = new char[size];
for(int i=0; i<candidate.length(); i++)
{
int pos = find_position_for(candidate.charAt(i),i);
for(int j=i; j<pos; j++) result[j]=' ';
if(pos==-1) result[candidate.length()-1] = candidate.charAt(i);
else result[pos] = candidate.charAt(i);
}
return result;
}
static int find_position_for(char character, int offset)
{
character-=((int)'a');
for(int i=offset; i<size; i++)
{
// System.out.println("checking "+String.valueOf((char)(character+((int)'a')))+" at "+i);
if(!map[character][i])
{
map[character][i]=true;
return i;
}
}
return -1;
}
static String move_right(String a, int from)
{
return a.substring(0, from)+" "+a.substring(from);
}
static boolean taken(int character, int position)
{ return map[character][position]; }
static void take(char character, int position)
{
//System.out.println("taking "+String.valueOf(character)+" at "+position+" (char_index-"+(character-((int)'a'))+")");
map[character-((int)'a')][position]=true;
}
static int max_size(Stack stack)
{
int max=0;
while(!stack.isEmpty())
{
String s = stack.pop();
if(s.length()>max) max=s.length();
}
return max;
}
}
Finding any common supersequence is not a difficult task:
In your example possible solution would be something like:
public class SuperSequenceTest {
public static void main(String[] args) {
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
int iA = 0;
int iB = 0;
int iC = 0;
char[] a = A.toCharArray();
char[] b = B.toCharArray();
char[] c = C.toCharArray();
StringBuilder sb = new StringBuilder();
while (iA < a.length || iB < b.length || iC < c.length) {
if (iA < a.length && iB < b.length && iC < c.length && (a[iA] == b[iB]) && (a[iA] == c[iC])) {
sb.append(a[iA]);
iA++;
iB++;
iC++;
}
else if (iA < a.length && iB < b.length && a[iA] == b[iB]) {
sb.append(a[iA]);
iA++;
iB++;
}
else if (iA < a.length && iC < c.length && a[iA] == c[iC]) {
sb.append(a[iA]);
iA++;
iC++;
}
else if (iB < b.length && iC < c.length && b[iB] == c[iC]) {
sb.append(b[iB]);
iB++;
iC++;
} else {
if (iC < c.length) {
sb.append(c[iC]);
iC++;
}
else if (iB < b.length) {
sb.append(b[iB]);
iB++;
} else if (iA < a.length) {
sb.append(a[iA]);
iA++;
}
}
}
System.out.println("SUPERSEQUENCE " + sb.toString());
}
}
However the real problem to solve is to find the solution for the known problem of Shortest Common Supersequence http://en.wikipedia.org/wiki/Shortest_common_supersequence,
which is not that easy.
There is a lot of researches which concern the topic.
See for instance:
http://www.csd.uwo.ca/~lila/pdfs/Towards%20a%20DNA%20solution%20to%20the%20Shortest%20Common%20Superstring%20Problem.pdf
http://www.ncbi.nlm.nih.gov/pubmed/14534185
You can try finding the shortest combination like this
static final char[] CHARS = "acgt".toCharArray();
public static void main(String[] ignored) {
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
String expected = "cagagaccatgccgtaaatgcattacga";
List<String> ABC = new Combination(A, B, C).findShortest();
System.out.println("expected: " + expected.length());
System.out.println("Merged: " + ABC.get(0).length() + " " + ABC);
}
static class Combination {
int shortest = Integer.MAX_VALUE;
List<String> shortestStr = new ArrayList<>();
char[][] chars;
int[] pos;
int count = 0;
Combination(String... strs) {
chars = new char[strs.length][];
pos = new int[strs.length];
for (int i = 0; i < strs.length; i++) {
chars[i] = strs[i].toCharArray();
}
}
public List<String> findShortest() {
findShortest0(new StringBuilder(), pos);
return shortestStr;
}
private void findShortest0(StringBuilder sb, int[] pos) {
if (allDone(pos)) {
if (sb.length() < shortest) {
shortestStr.clear();
shortest = sb.length();
}
if (sb.length() <= shortest)
shortestStr.add(sb.toString());
count++;
if (++count % 100 == 1)
System.out.println("Searched " + count + " shortest " + shortest);
return;
}
if (sb.length() + maxLeft(pos) > shortest)
return;
int[] pos2 = new int[pos.length];
int i = sb.length();
sb.append(' ');
for (char c : CHARS) {
if (!tryChar(pos, pos2, c)) continue;
sb.setCharAt(i, c);
findShortest0(sb, pos2);
}
sb.setLength(i);
}
private int maxLeft(int[] pos) {
int maxLeft = 0;
for (int i = 0; i < pos.length; i++) {
int left = chars[i].length - pos[i];
if (left > maxLeft)
maxLeft = left;
}
return maxLeft;
}
private boolean allDone(int[] pos) {
for (int i = 0; i < chars.length; i++)
if (pos[i] < chars[i].length)
return false;
return true;
}
private boolean tryChar(int[] pos, int[] pos2, char c) {
boolean matched = false;
for (int i = 0; i < chars.length; i++) {
pos2[i] = pos[i];
if (pos[i] >= chars[i].length) continue;
if (chars[i][pos[i]] == c) {
pos2[i]++;
matched = true;
}
}
return matched;
}
}
prints many solutions which are shorter than the one suggested.
expected: 28
Merged: 27 [acgaagccatccgctaaatgctatcga, acgaagccatccgctaaatgctatgca, acgaagccatccgctaacagtgctaga, acgaagccatccgctaacatgctatga, acgaagccatccgctaacatgcttaga, acgaagccatccgctaacatgtctaga, acgaagccatccgctacaagtgctaga, acgaagccatccgctacaatgctatga, acgaagccatccgctacaatgcttaga, acgaagccatccgctacaatgtctaga, acgaagccatcgcgtaaatgctatcga, acgaagccatcgcgtaaatgctatgca, acgaagccatcgcgtaacagtgctaga, acgaagccatcgcgtaacatgctatga, acgaagccatcgcgtaacatgcttaga, acgaagccatcgcgtaacatgtctaga, acgaagccatcgcgtacaagtgctaga, acgaagccatcgcgtacaatgctatga, acgaagccatcgcgtacaatgcttaga, acgaagccatcgcgtacaatgtctaga, acgaagccatgccgtaaatgctatcga, acgaagccatgccgtaaatgctatgca, acgaagccatgccgtaacagtgctaga, acgaagccatgccgtaacatgctatga, acgaagccatgccgtaacatgcttaga, acgaagccatgccgtaacatgtctaga, acgaagccatgccgtacaagtgctaga, acgaagccatgccgtacaatgctatga, acgaagccatgccgtacaatgcttaga, acgaagccatgccgtacaatgtctaga, cagaagccatccgctaaatgctatcga, cagaagccatccgctaaatgctatgca, cagaagccatccgctaacagtgctaga, cagaagccatccgctaacatgctatga, cagaagccatccgctaacatgcttaga, cagaagccatccgctaacatgtctaga, cagaagccatccgctacaagtgctaga, cagaagccatccgctacaatgctatga, cagaagccatccgctacaatgcttaga, cagaagccatccgctacaatgtctaga, cagaagccatcgcgtaaatgctatcga, cagaagccatcgcgtaaatgctatgca, cagaagccatcgcgtaacagtgctaga, cagaagccatcgcgtaacatgctatga, cagaagccatcgcgtaacatgcttaga, cagaagccatcgcgtaacatgtctaga, cagaagccatcgcgtacaagtgctaga, cagaagccatcgcgtacaatgctatga, cagaagccatcgcgtacaatgcttaga, cagaagccatcgcgtacaatgtctaga, cagaagccatgccgtaaatgctatcga, cagaagccatgccgtaaatgctatgca, cagaagccatgccgtaacagtgctaga, cagaagccatgccgtaacatgctatga, cagaagccatgccgtaacatgcttaga, cagaagccatgccgtaacatgtctaga, cagaagccatgccgtacaagtgctaga, cagaagccatgccgtacaatgctatga, cagaagccatgccgtacaatgcttaga, cagaagccatgccgtacaatgtctaga, cagagaccatccgctaaatgctatcga, cagagaccatccgctaaatgctatgca, cagagaccatccgctaacagtgctaga, cagagaccatccgctaacatgctatga, cagagaccatccgctaacatgcttaga, cagagaccatccgctaacatgtctaga, cagagaccatccgctacaagtgctaga, cagagaccatccgctacaatgctatga, cagagaccatccgctacaatgcttaga, cagagaccatccgctacaatgtctaga, cagagaccatcgcgtaaatgctatcga, cagagaccatcgcgtaaatgctatgca, cagagaccatcgcgtaacagtgctaga, cagagaccatcgcgtaacatgctatga, cagagaccatcgcgtaacatgcttaga, cagagaccatcgcgtaacatgtctaga, cagagaccatcgcgtacaagtgctaga, cagagaccatcgcgtacaatgctatga, cagagaccatcgcgtacaatgcttaga, cagagaccatcgcgtacaatgtctaga, cagagaccatgccgtaaatgctatcga, cagagaccatgccgtaaatgctatgca, cagagaccatgccgtaacagtgctaga, cagagaccatgccgtaacatgctatga, cagagaccatgccgtaacatgcttaga, cagagaccatgccgtaacatgtctaga, cagagaccatgccgtacaagtgctaga, cagagaccatgccgtacaatgctatga, cagagaccatgccgtacaatgcttaga, cagagaccatgccgtacaatgtctaga, cagagccatcctagctaaagtgctaga, cagagccatcctagctaaatgctatga, cagagccatcctagctaaatgcttaga, cagagccatcctagctaaatgtctaga, cagagccatcctgactaaagtgctaga, cagagccatcctgactaaatgctatga, cagagccatcctgactaaatgcttaga, cagagccatcctgactaaatgtctaga, cagagccatcctgctaaatgctatcga, cagagccatcctgctaaatgctatgca, cagagccatcctgctaacagtgctaga, cagagccatcctgctaacatgctatga, cagagccatcctgctaacatgcttaga, cagagccatcctgctaacatgtctaga, cagagccatcctgctacaagtgctaga, cagagccatcctgctacaatgctatga, cagagccatcctgctacaatgcttaga, cagagccatcctgctacaatgtctaga]

Count continuous repeated occurrence of characters from String

This is my code.
public static void countContinuosOccurence() {
String first = "ABBCDDDEFGGH";
StringBuffer result = new StringBuffer();
int count = 1;
for (int i = 1; i < first.length(); i++) {
if (first.charAt(i) == (first.charAt(i - 1))) {
count++;
} else {
if (count > 1) {
result.append(String.valueOf(count) + first.charAt(i - 1));
} else {
result.append(first.charAt(i - 1));
}
count = 1;
}
}
System.out.println("First String is:"+ first);
System.out.println("Result is:" + result);
}
The result is:
First String is:ABBCDDDEFGGH
Result is:A2BC3DEF2G
It is missing the last character? May someone help me to solve this?
Not top-performing, but simplest code:
final String in = "ABBCDDDEFGGH" + '\u0000';
final StringBuilder b = new StringBuilder();
char prev = in.charAt(0);
int rpt = 0;
for (int i = 1; i < in.length(); i++) {
final char curr = in.charAt(i);
if (curr == prev) rpt++;
else {
b.append(rpt == 0? prev : "" + (rpt + 1) + prev);
rpt = 0; prev = curr;
}
}
System.out.println(b);
After the for loop ends, you'll need to append the count and the character of the last run of character(s) to the result:
public static void countContinuosOccurence() {
String first = "ABBCDDDEFGGH";
StringBuffer result = new StringBuffer();
int count = 1;
int i;
for (i = 1; i < first.length(); i++) {
if (first.charAt(i) == (first.charAt(i - 1))) {
count++;
} else {
if (count > 1) {
result.append(String.valueOf(count) + first.charAt(i - 1));
} else {
result.append(first.charAt(i - 1));
}
count = 1;
}
}
// ADD THIS - to take care of the last run.
if (count > 1) {
result.append(String.valueOf(count) + first.charAt(i - 1));
} else {
result.append(first.charAt(i - 1));
}
System.out.println("First String is:"+ first);
System.out.println("Result is:" + result);
}
public static void countContinuosOccurence() {
String[] input = "ABBCDDDEFGGH".split("");
String out = "";
for (int i = 0; i < input.length; i++) {
int repeatedCharCount = 1;
String currentChr = input[i];
if (!(i == input.length - 1)) {
while (input[i].equals(input[i + 1])) {
repeatedCharCount++;
i++;
}
}
out = out + repeatedCharCount + currentChr;
}
System.out.println(out);
}
There is also a hidden problem, that is that if you are terminating with a sequence with more than one occurrence, you will not write anything.
The simplest way to solve this problem and the problem you detected is to add a final check after the for block
[...]
}
int l = first.length();
if (count > 1) {
result.append(String.valueOf(count) + first.charAt(l - 1));
} else {
result.append(first.charAt(l - 1));
}
}
System.out.println("First String is:"+ first);
System.out.println("Result is:" + result);
}
import java.util.*;
public class HelloWorld{
public static void main(String []args){
System.out.println("Hello World");
String first = "ABBCDDDEFGGHhhhhh456456456{{{67}}}";
StringBuffer result = new StringBuffer();
result.append(first);
System.out.println(result);
Map<Character,Integer> map = new HashMap<Character,Integer>();
for(int i = 0; i < first.length(); i++) {
char c = first.charAt(i);
if (map.containsKey(c)) {
int cnt = map.get(c);
map.put(c, ++cnt);
} else {
map.put(c, 1);
}
}
Set set = map.entrySet();
// Get an iterator
Iterator itr = set.iterator();
// Display elements
while(itr.hasNext()) {
Map.Entry me = (Map.Entry)itr.next();
System.out.print(me.getKey() + ": ");
System.out.println(me.getValue());
}
System.out.println("Hello World1");
}
}

Categories

Resources