I have a homework that the teacher test if it's corrects by checking it's output using this website moodle.caseine.org, so to test my code the program execute these lines and compare the output with the expected one, this is the test :
Tas t = new Tas();
Random r = new Random(123);
for(int i =0; i<10000;i++)t.inser(r.nextInt());
for(int i =0;i<10000;i++)System.out.println(t.supprMax());
System.out.println(t);
And my Heap (Tas) class:
package td1;
import java.util.ArrayList;
import java.util.List;
public class Tas {
private List<Integer> t;
public Tas() {
t = new ArrayList<>();
}
public Tas(ArrayList<Integer> tab) {
t = new ArrayList<Integer>(tab);
}
public static int getFilsGauche(int i) {
return 2 * i + 1;
}
public static int getFilsDroit(int i) {
return 2 * i + 2;
}
public static int getParent(int i) {
return (i - 1) / 2;
}
public boolean estVide() {
return t.isEmpty();
}
#Override
public String toString() {
String str = "";
int size = t.size();
if (size > 0) {
str += "[" + t.get(0);
str += toString(0);
str += "]";
}
return str;
}
public boolean testTas() {
int size = t.size();
int check = 0;
if (size > 0) {
for (int i = 0; i < t.size(); i++) {
if (getFilsGauche(i) < size) {
if (t.get(i) < t.get(getFilsGauche(i))) {
check++;
}
}
if (getFilsDroit(i) < size) {
if (t.get(i) < t.get(getFilsDroit(i))) {
check++;
}
}
}
}
return check == 0;
}
public String toString(int i) {
String str = "";
int size = t.size();
if (getFilsGauche(i) < size) {
str += "[";
str += t.get(getFilsGauche(i));
str += toString(getFilsGauche(i));
str += "]";
}
if (getFilsDroit(i) < size) {
str += "[";
str += t.get(getFilsDroit(i));
str += toString(getFilsDroit(i));
str += "]";
}
return str;
}
//insert value and sort
public void inser(int value) {
t.add(value);
int index = t.size() - 1;
if (index > 0) {
inserCheck(index); // O(log n)
}
}
public void inserCheck(int i) {
int temp = 0;
int parent = getParent(i);
if (parent >= 0 && t.get(i) > t.get(parent)) {
temp = t.get(parent);
t.set(parent, t.get(i));
t.set(i, temp);
inserCheck(parent);
}
}
//switch position of last element is list with first (deletes first and return it)
public int supprMax() {
int size = t.size();
int max = 0;
if (size > 0) {
max = t.get(0);
t.set(0, t.get(size - 1));
t.remove(size - 1);
supprMax(0);
}
else {
throw new IllegalStateException();
}
return max;
}
public void supprMax(int i) {
int size = t.size();
int temp = 0;
int index = i;
if (getFilsGauche(i) < size && t.get(getFilsGauche(i)) > t.get(index)) {
index = getFilsGauche(i);
}
if (getFilsDroit(i) < size && t.get(getFilsDroit(i)) > t.get(index)) {
index = getFilsDroit(i);
}
if (index != i) {
temp = t.get(index);
t.set(index, t.get(i));
t.set(i, temp);
supprMax(index);
}
}
public static void tri(int[] tab) {
Tas tas = new Tas();
for (int i = 0; i < tab.length; i++) {
tas.inser(tab[i]);
}
for (int i = 0; i < tab.length; i++) {
tab[i] = tas.supprMax();
}
}
}
The last 3 lines of the test are :
-2145024521
-2147061786
-2145666206
But the last 3 of my code are :
-2145024521
-2145666206
-2147061786
The problem are probably with the inser and supprMax methods.
I hate to get a bad grade just because of 3 lines placement, because it is a program that verify the code, it dosn't care the the solution was close, it's still says it's wrong.
Hy there. Below you can see sagment of my code. So lets go to the problem.
int i is not returning correct values and i cannot figure it out why.
LIST: [AGRFT, AGRFT, ARNES, ASCII, ASEAN, Aaron, Abdul, Abdul]
So for example. User inputs AS***, the program should return i is at 2. However i am getting i is at 0.
If i remember right it should go like this:
User_input= AS***
User_input.lenght() should be 5
first it should be user_input.charAt(0)=='*' NO
second it should be user_input.charAt(1)=='*' NO
third it should be user_input.charAt(2)=='*' YES
BREAK
i is at 2.
SO what am i missing?
I am getting 0.
Oh and also at
for(i=0; i < user_input.length();i++){
i am getting warning that i++ is Dead code?
if (dolzina == 5) {
for(i=0; i < user_input.length();i++){
if (user_input.charAt(i)=='*');
break;
}
System.out.println("i is at "+ i);
this is my full code for refrence. What it does it reads from txt file add wor
public class proba {
public static void main(String[] args) {
String izbira;
int dolzina=0;
int i=0;
Scanner in = new Scanner(System.in);
String user_input;
Scanner input = new Scanner(System.in);
String regex;
List<String> list5 = new ArrayList<String>();
int beseda;
String prefix = null;
try {
File file = new File("sort.txt");
FileReader fileReader = new FileReader(file);
BufferedReader bufferedReader = new BufferedReader(fileReader);
String vrstica;
while ((vrstica = bufferedReader.readLine()) != null) {
if (vrstica.length() == 5) {
list5.add(vrstica);
}
}
System.out.println(list5);
do{
do {
System.out.println("Enter lenght of word:");
if (in.hasNextInt()) {
dolzina = in.nextInt();
} else if (in.hasNextLine()) {
System.out.printf("Wrong entry!%n ",
in.nextLine());
}
} while (dolzina <= 0);
Collections.sort(list5);
System.out.println("Enter a word for unknown character enter * :");
user_input = input.nextLine();
System.out.println("Sorted list: [length: " + list5.size() + "]");
if (dolzina == 5) {
for(i=0; i < user_input.length();i++){
if (user_input.charAt(i)=='*');
break;
}
System.out.println("i je"+ i);
prefix=user_input.substring(0,i);
System.out.println(prefix);
int start=binarySearchfirst(list5,prefix);
int end=binarySearchlast(list5,prefix);
System.out.println(start);
System.out.println(end);
for (int b=start;b<=end;b++)
{
user_input = user_input.replace("*", ".");
String s = (String) list5.get(b);
if (s.matches(user_input))
System.out.println(s);
}
}
dolzina=-1;
System.out.println("Ponovni vnos (da/ne):");
Scanner inn= new Scanner (System.in);
izbira = inn.next();
}while (izbira.equalsIgnoreCase("da"));
bufferedReader.close();
} catch (IOException e) {
e.printStackTrace();
}}
public static int binarySearchfirst(List<String> integerList, String prefix) {
int low = 0;
int high = integerList.size() - 1;
while (low <= high) {
int mid = (low + high) / 2;
if (integerList.get(mid).startsWith(prefix)) {
if (mid == 0 || !integerList.get(mid - 1).startsWith(prefix)) {
return mid;
} else {
high = mid - 1;
}
} else if (prefix.compareTo(integerList.get(mid)) > 0) {
low = mid + 1;
} else {
high = mid - 1;
}
}
return low;
}
public static int binarySearchlast(List<String> integerList, String prefix) {
int low = 0;
int high = integerList.size()-1;
while (low <= high) {
int mid = (low+high)/2;
if (integerList.get(mid).startsWith(prefix)) {
if (mid == integerList.size()-1 || !integerList.get(mid+1).startsWith(prefix)) {
return mid;
}
else {
low = mid+1;
}
}
else if (prefix.compareTo(integerList.get(mid)) > 0) {
low = mid+1;
}
else {
high = mid-1;
}
}
return high;
}
}
You have an extra semi-colon after your if statement:
for(i=0; i < user_input.length();i++)
{ if (user_input.charAt(i)=='*');
break;
}
So the break is executed the first time through the loop no matter what. This is also why i++ is being reported as dead code...it's never being executed.
I'm trying to implement KMP algorithm. My algorithm works correctly with the following example
Text: 121121
Pattern: 121
Result: 1,4
But when Text is 12121 and pattern is the same as above, result just: 1. I don't know if this is the problem of the algorithm or of my implementation?
Other example:
Text: 1111111111
Pattern: 111
Result: 1,4,7
My code is:
public class KMP {
public static void main(String[] args) throws IOException{
BufferedReader reader = new BufferedReader(new InputStreamReader(System.in));
String text = reader.readLine();
String pattern = reader.readLine();
search(text,pattern);
}
private static void search(String text,String pattern)
{
int[] Pi = Pi(pattern);
for (int i = 0,q=0; i <text.length()&&q<pattern.length() ; i++,q++) {
while (q>=0 && pattern.charAt(q)!=text.charAt(i))
{
q=Pi[q];
}
if(q==pattern.length()-1) {
System.out.println(i-pattern.length()+2);
q=Pi[q];
}
}
}
private static int[] Pi(String p) {
int[] Pi = new int[p.length()];
Pi[0]=-1;
int i=0;
int j=-1;
while (i<p.length()-1) {
while (j>=0 && p.charAt(j)!=p.charAt(i))
{
j=Pi[j];
}
i++;
j++;
if(p.charAt(j)==p.charAt(i)) Pi[i]=Pi[j];
else Pi[i]=j;
}
return Pi;
}
}
Hope help you.
public int strStr(String source, String target) {
if (source == null || target == null){
return -1;
}
if (source.isEmpty() && !target.isEmpty()){
return -1;
}
if (source.isEmpty() && target.isEmpty()){
return 0;
}
if (target.isEmpty()){
return 0;
}
int index = 0;
int compare_index = 0;
int compare_start_index = 0;
int compare_same_length = 0;
List<Integer> answers = new ArrayList<Integer>();
while (true){
if (compare_same_length ==0){
compare_start_index = compare_index;
}
if (source.charAt(compare_index) == target.charAt(index)){
compare_same_length++;
index++;
} else {
if (compare_same_length >0){
compare_index--;
}
compare_same_length = 0;
index = 0;
}
compare_index++;
if (compare_same_length == target.length()){
answers.add(compare_start_index+1);
compare_same_length=0;
index=0;
}
if (compare_index == source.length()){
//here are answers
for (int i = 0; i < answers.size(); i++) {
int value = answers.get(i);
}
return 1;
}
}
}
import java.util.InputMismatchException;
import java.util.Scanner;
import java.util.Stack;
public class TSPNearestNeighbour {
{
private final Stack<Integer> stack;
private int numberOfNodes;
public TSPNearestNeighbour()
{
stack = new Stack<Integer>();
}
public void tsp(int adjacencyMatrix[][])
{
numberOfNodes = adjacencyMatrix[1].length - 1;
int[] visited = new int[numberOfNodes + 1];
visited[1] = 1;
stack.push(1);
int element, dst = 0, i,cost=0;
int min = Integer.MAX_VALUE;
boolean minFlag = false;
System.out.print(1 + "\t");
while (!stack.isEmpty())
{
element = stack.peek();
i = 1;
min = Integer.MAX_VALUE;
while (i <= numberOfNodes)
{
if (adjacencyMatrix[element][i] > 1 && visited[i] == 0)
{
if (min > adjacencyMatrix[element][i])
{
min = adjacencyMatrix[element][i];
cost=cost+adjacencyMatrix[element][i];
dst = i;
minFlag = true;
}
}
i++;
}
if (minFlag)
{
visited[dst] = 1;
stack.push(dst);
System.out.print( dst + "\t");
minFlag = false;
continue;
}
stack.pop();
}
System.out.println("total cost" +cost);
}
public static void main(String args[])
{
int number_of_nodes;
Scanner scanner = null;
try
{
System.out.println("Enter the number of nodes in the graph");
scanner = new Scanner(System.in);
number_of_nodes = scanner.nextInt();
int adjacency_matrix[][] = new int[number_of_nodes + 1][number_of_nodes + 1];
System.out.println("Enter the adjacency matrix");
for (int i = 1; i <= number_of_nodes; i++)
{
for (int j = 1; j <= number_of_nodes; j++)
{
adjacency_matrix[i][j] = scanner.nextInt();
}
}
for (int i = 1; i <= number_of_nodes; i++)
{
for (int j = 1; j <= number_of_nodes; j++)
{
if (adjacency_matrix[i][j] == 1 && adjacency_matrix[j][i] == 0)
{
adjacency_matrix[j][i] = 1;
}
}
}
System.out.println("the citys are visited as follows");
TSPNearestNeighbour tspNearestNeighbour = new TSPNearestNeighbour();
tspNearestNeighbour.tsp(adjacency_matrix);
} catch (InputMismatchException inputMismatch)
{
System.out.println("Wrong Input format");
}
scanner.close();
}
}
> illegal start of expression in the line:
> **private final Stack<Integer> stack;**
You have 2 open braces
public class TSPNearestNeighbour { {
remove one and may be you get your code compiled
I am struggling with a "find supersequence" algorithm.
The input is for set of strings
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
the result would be properly aligned set of strings (and next step should be merge)
String E = "ca ag cca cc ta cat c a";
String F = "c gag ccat ccgtaaa g tt g";
String G = " aga acc tgc taaatgc t a ga";
Thank you for any advice (I am sitting on this task for more than a day)
after merge the superstring would be
cagagaccatgccgtaaatgcattacga
The definition of supersequence in "this case" would be something like
The string R is contained in supersequence S if and only if all characters in a string R are present in supersequence S in the order in which they occur in the input sequence R.
The "solution" i tried (and again its the wrong way of doing it) is:
public class Solution4
{
static boolean[][] map = null;
static int size = 0;
public static void main(String[] args)
{
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
Stack data = new Stack();
data.push(A);
data.push(B);
data.push(C);
Stack clone1 = data.clone();
Stack clone2 = data.clone();
int length = 26;
size = max_size(data);
System.out.println(size+" "+length);
map = new boolean[26][size];
char[] result = new char[size];
HashSet<String> chunks = new HashSet<String>();
while(!clone1.isEmpty())
{
String a = clone1.pop();
char[] residue = make_residue(a);
System.out.println("---");
System.out.println("OLD : "+a);
System.out.println("RESIDUE : "+String.valueOf(residue));
String[] r = String.valueOf(residue).split(" ");
for(int i=0; i<r.length; i++)
{
if(r[i].equals(" ")) continue;
//chunks.add(spaces.substring(0,i)+r[i]);
chunks.add(r[i]);
}
}
for(String chunk : chunks)
{
System.out.println("CHUNK : "+chunk);
}
}
static char[] make_residue(String candidate)
{
char[] result = new char[size];
for(int i=0; i<candidate.length(); i++)
{
int pos = find_position_for(candidate.charAt(i),i);
for(int j=i; j<pos; j++) result[j]=' ';
if(pos==-1) result[candidate.length()-1] = candidate.charAt(i);
else result[pos] = candidate.charAt(i);
}
return result;
}
static int find_position_for(char character, int offset)
{
character-=((int)'a');
for(int i=offset; i<size; i++)
{
// System.out.println("checking "+String.valueOf((char)(character+((int)'a')))+" at "+i);
if(!map[character][i])
{
map[character][i]=true;
return i;
}
}
return -1;
}
static String move_right(String a, int from)
{
return a.substring(0, from)+" "+a.substring(from);
}
static boolean taken(int character, int position)
{ return map[character][position]; }
static void take(char character, int position)
{
//System.out.println("taking "+String.valueOf(character)+" at "+position+" (char_index-"+(character-((int)'a'))+")");
map[character-((int)'a')][position]=true;
}
static int max_size(Stack stack)
{
int max=0;
while(!stack.isEmpty())
{
String s = stack.pop();
if(s.length()>max) max=s.length();
}
return max;
}
}
Finding any common supersequence is not a difficult task:
In your example possible solution would be something like:
public class SuperSequenceTest {
public static void main(String[] args) {
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
int iA = 0;
int iB = 0;
int iC = 0;
char[] a = A.toCharArray();
char[] b = B.toCharArray();
char[] c = C.toCharArray();
StringBuilder sb = new StringBuilder();
while (iA < a.length || iB < b.length || iC < c.length) {
if (iA < a.length && iB < b.length && iC < c.length && (a[iA] == b[iB]) && (a[iA] == c[iC])) {
sb.append(a[iA]);
iA++;
iB++;
iC++;
}
else if (iA < a.length && iB < b.length && a[iA] == b[iB]) {
sb.append(a[iA]);
iA++;
iB++;
}
else if (iA < a.length && iC < c.length && a[iA] == c[iC]) {
sb.append(a[iA]);
iA++;
iC++;
}
else if (iB < b.length && iC < c.length && b[iB] == c[iC]) {
sb.append(b[iB]);
iB++;
iC++;
} else {
if (iC < c.length) {
sb.append(c[iC]);
iC++;
}
else if (iB < b.length) {
sb.append(b[iB]);
iB++;
} else if (iA < a.length) {
sb.append(a[iA]);
iA++;
}
}
}
System.out.println("SUPERSEQUENCE " + sb.toString());
}
}
However the real problem to solve is to find the solution for the known problem of Shortest Common Supersequence http://en.wikipedia.org/wiki/Shortest_common_supersequence,
which is not that easy.
There is a lot of researches which concern the topic.
See for instance:
http://www.csd.uwo.ca/~lila/pdfs/Towards%20a%20DNA%20solution%20to%20the%20Shortest%20Common%20Superstring%20Problem.pdf
http://www.ncbi.nlm.nih.gov/pubmed/14534185
You can try finding the shortest combination like this
static final char[] CHARS = "acgt".toCharArray();
public static void main(String[] ignored) {
String A = "caagccacctacatca";
String B = "cgagccatccgtaaagttg";
String C = "agaacctgctaaatgctaga";
String expected = "cagagaccatgccgtaaatgcattacga";
List<String> ABC = new Combination(A, B, C).findShortest();
System.out.println("expected: " + expected.length());
System.out.println("Merged: " + ABC.get(0).length() + " " + ABC);
}
static class Combination {
int shortest = Integer.MAX_VALUE;
List<String> shortestStr = new ArrayList<>();
char[][] chars;
int[] pos;
int count = 0;
Combination(String... strs) {
chars = new char[strs.length][];
pos = new int[strs.length];
for (int i = 0; i < strs.length; i++) {
chars[i] = strs[i].toCharArray();
}
}
public List<String> findShortest() {
findShortest0(new StringBuilder(), pos);
return shortestStr;
}
private void findShortest0(StringBuilder sb, int[] pos) {
if (allDone(pos)) {
if (sb.length() < shortest) {
shortestStr.clear();
shortest = sb.length();
}
if (sb.length() <= shortest)
shortestStr.add(sb.toString());
count++;
if (++count % 100 == 1)
System.out.println("Searched " + count + " shortest " + shortest);
return;
}
if (sb.length() + maxLeft(pos) > shortest)
return;
int[] pos2 = new int[pos.length];
int i = sb.length();
sb.append(' ');
for (char c : CHARS) {
if (!tryChar(pos, pos2, c)) continue;
sb.setCharAt(i, c);
findShortest0(sb, pos2);
}
sb.setLength(i);
}
private int maxLeft(int[] pos) {
int maxLeft = 0;
for (int i = 0; i < pos.length; i++) {
int left = chars[i].length - pos[i];
if (left > maxLeft)
maxLeft = left;
}
return maxLeft;
}
private boolean allDone(int[] pos) {
for (int i = 0; i < chars.length; i++)
if (pos[i] < chars[i].length)
return false;
return true;
}
private boolean tryChar(int[] pos, int[] pos2, char c) {
boolean matched = false;
for (int i = 0; i < chars.length; i++) {
pos2[i] = pos[i];
if (pos[i] >= chars[i].length) continue;
if (chars[i][pos[i]] == c) {
pos2[i]++;
matched = true;
}
}
return matched;
}
}
prints many solutions which are shorter than the one suggested.
expected: 28
Merged: 27 [acgaagccatccgctaaatgctatcga, acgaagccatccgctaaatgctatgca, acgaagccatccgctaacagtgctaga, acgaagccatccgctaacatgctatga, acgaagccatccgctaacatgcttaga, acgaagccatccgctaacatgtctaga, acgaagccatccgctacaagtgctaga, acgaagccatccgctacaatgctatga, acgaagccatccgctacaatgcttaga, acgaagccatccgctacaatgtctaga, acgaagccatcgcgtaaatgctatcga, acgaagccatcgcgtaaatgctatgca, acgaagccatcgcgtaacagtgctaga, acgaagccatcgcgtaacatgctatga, acgaagccatcgcgtaacatgcttaga, acgaagccatcgcgtaacatgtctaga, acgaagccatcgcgtacaagtgctaga, acgaagccatcgcgtacaatgctatga, acgaagccatcgcgtacaatgcttaga, acgaagccatcgcgtacaatgtctaga, acgaagccatgccgtaaatgctatcga, acgaagccatgccgtaaatgctatgca, acgaagccatgccgtaacagtgctaga, acgaagccatgccgtaacatgctatga, acgaagccatgccgtaacatgcttaga, acgaagccatgccgtaacatgtctaga, acgaagccatgccgtacaagtgctaga, acgaagccatgccgtacaatgctatga, acgaagccatgccgtacaatgcttaga, acgaagccatgccgtacaatgtctaga, cagaagccatccgctaaatgctatcga, cagaagccatccgctaaatgctatgca, cagaagccatccgctaacagtgctaga, cagaagccatccgctaacatgctatga, cagaagccatccgctaacatgcttaga, cagaagccatccgctaacatgtctaga, cagaagccatccgctacaagtgctaga, cagaagccatccgctacaatgctatga, cagaagccatccgctacaatgcttaga, cagaagccatccgctacaatgtctaga, cagaagccatcgcgtaaatgctatcga, cagaagccatcgcgtaaatgctatgca, cagaagccatcgcgtaacagtgctaga, cagaagccatcgcgtaacatgctatga, cagaagccatcgcgtaacatgcttaga, cagaagccatcgcgtaacatgtctaga, cagaagccatcgcgtacaagtgctaga, cagaagccatcgcgtacaatgctatga, cagaagccatcgcgtacaatgcttaga, cagaagccatcgcgtacaatgtctaga, cagaagccatgccgtaaatgctatcga, cagaagccatgccgtaaatgctatgca, cagaagccatgccgtaacagtgctaga, cagaagccatgccgtaacatgctatga, cagaagccatgccgtaacatgcttaga, cagaagccatgccgtaacatgtctaga, cagaagccatgccgtacaagtgctaga, cagaagccatgccgtacaatgctatga, cagaagccatgccgtacaatgcttaga, cagaagccatgccgtacaatgtctaga, cagagaccatccgctaaatgctatcga, cagagaccatccgctaaatgctatgca, cagagaccatccgctaacagtgctaga, cagagaccatccgctaacatgctatga, cagagaccatccgctaacatgcttaga, cagagaccatccgctaacatgtctaga, cagagaccatccgctacaagtgctaga, cagagaccatccgctacaatgctatga, cagagaccatccgctacaatgcttaga, cagagaccatccgctacaatgtctaga, cagagaccatcgcgtaaatgctatcga, cagagaccatcgcgtaaatgctatgca, cagagaccatcgcgtaacagtgctaga, cagagaccatcgcgtaacatgctatga, cagagaccatcgcgtaacatgcttaga, cagagaccatcgcgtaacatgtctaga, cagagaccatcgcgtacaagtgctaga, cagagaccatcgcgtacaatgctatga, cagagaccatcgcgtacaatgcttaga, cagagaccatcgcgtacaatgtctaga, cagagaccatgccgtaaatgctatcga, cagagaccatgccgtaaatgctatgca, cagagaccatgccgtaacagtgctaga, cagagaccatgccgtaacatgctatga, cagagaccatgccgtaacatgcttaga, cagagaccatgccgtaacatgtctaga, cagagaccatgccgtacaagtgctaga, cagagaccatgccgtacaatgctatga, cagagaccatgccgtacaatgcttaga, cagagaccatgccgtacaatgtctaga, cagagccatcctagctaaagtgctaga, cagagccatcctagctaaatgctatga, cagagccatcctagctaaatgcttaga, cagagccatcctagctaaatgtctaga, cagagccatcctgactaaagtgctaga, cagagccatcctgactaaatgctatga, cagagccatcctgactaaatgcttaga, cagagccatcctgactaaatgtctaga, cagagccatcctgctaaatgctatcga, cagagccatcctgctaaatgctatgca, cagagccatcctgctaacagtgctaga, cagagccatcctgctaacatgctatga, cagagccatcctgctaacatgcttaga, cagagccatcctgctaacatgtctaga, cagagccatcctgctacaagtgctaga, cagagccatcctgctacaatgctatga, cagagccatcctgctacaatgcttaga, cagagccatcctgctacaatgtctaga]