Using scanner to read file and group data

Using scanner to read file and group data - java

I'm using scanner to read file and group data , ive done some work but facing problem when im tring to deal with
The data sets is this.
You can see a example here, that explain everything.
What i ve done is this :
import java.io.File;
import java.io.FileInputStream;
import java.io.FileNotFoundException;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
import java.util.Scanner;
public class TextScanner {
// static File f = new File("nrp1.txt");
public static void main(String[] args) throws FileNotFoundException {
TextScanner ts = new TextScanner();
ts.readfile();
}
public void readfile() throws FileNotFoundException {
FileInputStream fis = new FileInputStream("nrp1.txt");
Scanner scanner = new Scanner(fis);
int lineCount = 0;
String firstline = scanner.nextLine();
String secondline = scanner.nextLine();
String thirdline = scanner.nextLine();
String fourthline = scanner.nextLine();
String fifthline = scanner.nextLine();
String sixthline = scanner.nextLine();
String seventhline = scanner.nextLine();
String eighththline = scanner.nextLine();
List<Integer> intArrRIDA = new ArrayList<Integer>();
List<Integer> intArrRIDB = new ArrayList<Integer>();
int[] intRIDA = new int[Integer.parseInt(eighththline)];
int[] intRIDB = new int[Integer.parseInt(eighththline)];
List<Integer> intArrPOC = new ArrayList<Integer>();
List<Integer> intArrNORBC = new ArrayList<Integer>();
List<Integer> intArrRL = new ArrayList<Integer>();
String NoC="";
// COR arrays
thirdline.trim();
String[] CoR1 = thirdline.split(" ");
int[] intCoR1 = new int[CoR1.length];
for (int i = 0; i < intCoR1.length; i++) {
intCoR1[i] = Integer.parseInt(CoR1[i]);
}
fifthline.trim();
String[] CoR2 = fifthline.split(" ");
int[] intCoR2 = new int[CoR2.length];
for (int i = 0; i < intCoR2.length; i++) {
intCoR2[i] = Integer.parseInt(CoR2[i]);
}
seventhline.trim();
String[] CoR3 = seventhline.split(" ");
int[] intCoR3 = new int[CoR3.length];
for (int i = 0; i < intCoR3.length; i++) {
intCoR3[i] = Integer.parseInt(CoR3[i]);
}
while (scanner.hasNextLine()) {
lineCount++;
String line = scanner.nextLine().trim();
if (lineCount >= 1 && lineCount <= Integer.parseInt(eighththline)) {
// System.out.println("line: " + line);
String[] RID = line.split(" ");
for (int i = 0; i < 1; i++) {
intArrRIDA.add(Integer.parseInt(RID[0]));
intArrRIDB.add(Integer.parseInt(RID[1]));
// intRIDA[i] = Integer.parseInt(RID[0]);
// intRIDB[i] = Integer.parseInt(RID[1]);
// System.out.println("Id of RequirementA : " + intRIDA[i]);
// System.out.println("Id of RequirementB : " + intRIDB[i]);
}
}
if (lineCount == Integer.parseInt(eighththline)) {
NoC = scanner.nextLine();
}
//System.out.println("Number of Customer : " + NoC);
if (lineCount > Integer.parseInt(eighththline)) {
// System.out.println("line: " + line);
String[] Customers = line.split(" ");
System.out.println("Details of Customer : " +Arrays.toString(Customers) );
intArrPOC.add(Integer.parseInt(Customers[0]));
intArrNORBC.add(Integer.parseInt(Customers[1]));
for (int i = 0; i < 6; i++) {
intArrRL.add(Integer.parseInt(Customers[2]));
if (Customers[3] != null) {
intArrRL.add(Integer.parseInt(Customers[3]));
}
else if (Customers[4] != null) {
intArrRL.add(Integer.parseInt(Customers[4]));
}
else if (Customers[5] != null) {
intArrRL.add(Integer.parseInt(Customers[5]));
}
else if (Customers[6] != null) {
intArrRL.add(Integer.parseInt(Customers[6]));
}
else
continue;
}
}
}
System.out.println("Level of requirements, t: " + firstline);
System.out.println("Number of requirements in Level 1: " + secondline);
System.out.println("Costs of requirements in Level 1 : "
+ Arrays.toString(intCoR1));
System.out.println("Number of requirements in Level 2: " + fourthline);
System.out.println("Costs of requirements in Level 2 : "
+ Arrays.toString(intCoR2));
System.out.println("Number of requirements in Level 3: " + sixthline);
System.out.println("Costs of requirements in Level 3 : "
+ Arrays.toString(intCoR3));
System.out.println("Number of dependencies: " + eighththline);
// System.out.println("Id of RequirementA : " +
// Arrays.toString(intRIDA));
// System.out.println("Id of RequirementB : " +
// Arrays.toString(intRIDB));
System.out.println("Id of RequirementA : " + intArrRIDA);
System.out.println("Id of RequirementB : " + intArrRIDB);
System.out.println("Number of Customer : " + NoC);
System.out.println("Profit of Customer : " + intArrPOC);
System.out.println("Number of requests by Customer: " + intArrNORBC);
System.out.println("Requirements List : " + intArrRL);
}
private boolean isNumeric(String number) {
try {
Integer.parseInt(number);
return true;
} catch (NumberFormatException e) {
return false;
}
}
}
But as you can see :
for (int i = 0; i < 6; i++) {
intArrRL.add(Integer.parseInt(Customers[2]));
if (Customers[3] != null) {
intArrRL.add(Integer.parseInt(Customers[3]));
}
else if (Customers[4] != null) {
intArrRL.add(Integer.parseInt(Customers[4]));
}
else if (Customers[5] != null) {
intArrRL.add(Integer.parseInt(Customers[5]));
}
else if (Customers[6] != null) {
intArrRL.add(Integer.parseInt(Customers[6]));
}
else
continue;
}
This part is not correct ,and i need them to linked with Profit of Customer and Number of requests by Customer and when i implement further stuffs, i may able to find the corresponding Requirements List and the number of request by Profit of Customer...
I haven't started doing this method yet but that would be great if you can help me with this as well!
Thanks!

Related

Problem with reading textfiles with scanner in Java and ArrayLists

I'm having a problem where I read a textfile named "songs.txt" with Scanner in a function called loadFiles() which every line is:
Music ID # Song Name # Release Date
And with this I create a Song object, and then store said object in a ArrayList. After reading the file, I clone this ArrayList so I can return a ArrayList with the songs read and clear the first ArrayList to prevent the cases where for exemple:
(PS: I use the ArrayLists as global variables)
songs.txt has this structure:
1oYYd2gnWZYrt89EBXdFiO#Message In A Bottle#1979
7zxc7dmd82nd92nskDInds#Sweet Child of Mine#1980
And the loadFiles() is called 2 times, the ArrayList would have a size of 4 instead of 2 as it should be. So that's why after songs.txt is read I copy the arrayList and then clear the first ArrayList that way the ArrayList that's returned only has the size of 2.
This is my code:
package pt.ulusofona.aed.deisiRockstar2021;
import java.io.IOException;
import java.util.Scanner;
import java.io.*;
import java.util.ArrayList;
public class Main {
public static ArrayList < Song > teste6 = new ArrayList < > ();
public static ArrayList < Song > getSongsArray = new ArrayList < > ();
public static ArrayList < Artista > testeSongArtists = new ArrayList < > ();
public static ParseInfo parseInfoSongsTxT = new ParseInfo(0, 0);
public static ParseInfo parseInfoSongsArtistsTxT = new ParseInfo(0, 0);
public static ParseInfo parseInfoSongsDetailsTxT = new ParseInfo(0, 0);
public static void main(String[] args) throws IOException {
ArrayList < Song > teste7 = new ArrayList < Song > ();
loadFiles();
loadFiles();
teste7 = getSongs();
ParseInfo teste8 = getParseInfo("songs.txt");
System.out.println("\n----------------------TESTE DO MAIN----------------------");
System.out.println(teste7.toString());
System.out.println(teste8.toString());
System.out.println(getSongsArray.size());
}
public static void loadFiles() throws IOException {
//Aqui lê-se o ficheiro songs.txt
System.out.println("----------------------LEITURA DO FICHEIRO songs.txt------------");
String nomeFicheiro = "songs.txt";
try {
File ficheiro = new File(nomeFicheiro);
FileInputStream fis = new FileInputStream(ficheiro);
Scanner leitorFicheiro = new Scanner(fis);
while (leitorFicheiro.hasNextLine()) {
String linha = leitorFicheiro.nextLine();
String dados[] = linha.split("#");
if (dados.length != 3) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[0].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[1].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[2].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
//Meter para ignorar a acabar com espaço
parseInfoSongsTxT.NUM_LINHAS_OK += 1;
String idTemaMusical = dados[0];
String nome = dados[1];
int anoLancamento = Integer.parseInt(dados[2]);
Song song = new Song(idTemaMusical, nome, null, anoLancamento, 0, false, 0, 0, 0, 0);
teste6.add(song);
}
leitorFicheiro.close();
getSongsArray = (ArrayList < Song > ) teste6.clone();
teste6.clear();
} catch (FileNotFoundException exception) {
String mensagem = "Erro: o ficheiro " + nomeFicheiro + " nao foi encontrado.";
System.out.println(mensagem);
}
System.out.println(teste6.toString());
System.out.println("Ok: " + parseInfoSongsTxT.NUM_LINHAS_OK + ", Ignored: " + parseInfoSongsTxT.NUM_LINHAS_IGNORED + "\n");
System.out.println("----------------------LEITURA DO FICHEIRO song_artists.txt------------");
//Aqui é lido o ficheiro song_artists.txt, mas falta ver se é preciso separar vários artistas com o mesmo ID para posições diferentes no ArrayList
String nomeFicheiro2 = "song_artists.txt";
try {
File song_artists = new File(nomeFicheiro2);
FileInputStream fis2 = new FileInputStream(song_artists);
Scanner leitorFicheiro2 = new Scanner(fis2);
while (leitorFicheiro2.hasNextLine()) {
String linha = leitorFicheiro2.nextLine();
String dados[] = linha.split("#");
if (dados.length != 2) {
parseInfoSongsArtistsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[0].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[1].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
parseInfoSongsArtistsTxT.NUM_LINHAS_OK += 1;
String idTemaMusical = dados[0];
String artista = dados[1];
Artista artista2 = new Artista(idTemaMusical, artista);
testeSongArtists.add(artista2);
}
leitorFicheiro2.close();
} catch (FileNotFoundException exception) {
String mensagem = "Erro: o ficheiro " + nomeFicheiro2 + " não foi encontrado.";
System.out.println(mensagem);
}
System.out.println(testeSongArtists.toString());
System.out.println("Ok: " + parseInfoSongsArtistsTxT.NUM_LINHAS_OK + ", Ignored: " + parseInfoSongsArtistsTxT.NUM_LINHAS_IGNORED + "\n");
System.out.println("----------------------LEITURA DO FICHEIRO song_details.txt------------");
//Aqui lê-se o ficheiro song_details.txt
boolean letra = false;
ArrayList < Song > testeSongDetails = new ArrayList < Song > ();
String nomeFicheiro3 = "song_details.txt";
try {
File song_details = new File(nomeFicheiro3);
FileInputStream fis3 = new FileInputStream(song_details);
Scanner leitorFicheiro3 = new Scanner(fis3);
while (leitorFicheiro3.hasNextLine()) {
String linha = leitorFicheiro3.nextLine();
String dados[] = linha.split("#");
if (dados.length != 7) {
parseInfoSongsDetailsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[0].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[1].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[3].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[4].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[5].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
if (Character.isWhitespace(dados[6].charAt(0))) {
parseInfoSongsTxT.NUM_LINHAS_IGNORED += 1;
continue;
}
parseInfoSongsDetailsTxT.NUM_LINHAS_OK += 1;
String idTemaMusical = dados[0];
//System.out.println(idTemaMusical);
int duracao = Integer.parseInt(dados[1]);
//System.out.println(duracao);
int letraExplicita = Integer.parseInt(dados[2]);
//System.out.println(letraExplicita);
if (letraExplicita == 0) {
letra = false;
} else {
letra = true;
}
//System.out.println(letra);
int populariedade = Integer.parseInt(dados[3]);
//System.out.println(populariedade);
double dancabilidade = Double.parseDouble(dados[4]);
//System.out.println(dancabilidade);
double vivacidade = Double.parseDouble(dados[5]);
//System.out.println(vivacidade);
double volumeMedio = Double.parseDouble(dados[6]);
//System.out.println(volumeMedio);
Song song = new Song(idTemaMusical, null, null, 0, duracao, letra, populariedade, dancabilidade, vivacidade, volumeMedio);
testeSongDetails.add(song);
}
leitorFicheiro3.close();
} catch (FileNotFoundException exception) {
String mensagem = "Erro: o ficheiro " + nomeFicheiro3 + " não foi encontrado.";
System.out.println(mensagem);
}
System.out.println("Ok: " + parseInfoSongsDetailsTxT.NUM_LINHAS_OK + ", Ignored: " + parseInfoSongsDetailsTxT.NUM_LINHAS_IGNORED);
}
public static ArrayList < Song > getSongs() {
return getSongsArray;
}
public static ParseInfo getParseInfo(String fileName) {
if (fileName == "songs.txt") {
return parseInfoSongsTxT;
}
if (fileName == "song_artists.txt") {
return parseInfoSongsArtistsTxT;
}
if (fileName == "song_details.txt") {
return parseInfoSongsDetailsTxT;
}
return null;
}
}
The problem is that when I made a test to check the function where the ArrayList is returned to see the size of the ArrayList it always comes as 0.
I think it's because only the function the returns the ArrayList is tested so loadFiles() isn't executed so the ArrayListo never gets cloned and that makes the ArrayList that is returned stay the same.
I thought about calling loadFiles() inside getSongs() and that way I would guarantee that the ArrayList is cloned but that would make getSongs use "throws IOException" and since I have to respect the school's project guide and getSongs doesn't include "throws IOException" i can't put it there.
But the more I think about it, that doesn't even make sense because how can they test it with a file of their own and loadFiles() isn't executed?
I'm out of ideas how to solve this problem, any help is welcome thank you.

Error message for StorageResource type

I've been trying to work on this problem for a while now but to no avail. When I run the code I get this error message: incompatible types: edu.duke.StorageResource cannot be converted to java.lang.String on line String geneList = FMG.storeAll(dna);. Does this mean I'm trying to make edu.duke object work with a java.lang.String type object? What would we go about resolving this issue?
Here's my code so far:
package coursera_java_duke;
import java.io.*;
import edu.duke.FileResource;
import edu.duke.StorageResource;
import edu.duke.DirectoryResource;
public class FindMultiGenes5 {
public int findStopIndex(String dna, int index) {
int stop1 = dna.indexOf("TGA", index);
if (stop1 == -1 || (stop1 - index) % 3 != 0) {
stop1 = dna.length();
}
int stop2 = dna.indexOf("TAA", index);
if (stop2 == -1 || (stop2 - index) % 3 != 0) {
stop2 = dna.length();
}
int stop3 = dna.indexOf("TAG", index);
if (stop3 == -1 || (stop3 - index) % 3 != 0) {
stop3 = dna.length();
}
return Math.min(stop1, Math.min(stop2, stop3));
}
public StorageResource storeAll(String dna) {
//CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCAdna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA";
String geneAL = new String();
String sequence = dna.toUpperCase();
StorageResource store = new StorageResource();
int index = 0;
while (true) {
index = sequence.indexOf("ATG", index);
if (index == -1)
break;
int stop = findStopIndex(sequence, index + 3);
if (stop != sequence.length()) {
String gene = dna.substring(index, stop + 3);
store.add(gene);
//index = sequence.substring(index, stop + 3).length();
index = stop + 3; // start at the end of the stop codon
}else{ index = index + 3;
}
}
return store;//System.out.println(sequence);
}
public void testStorageFinder() {
DirectoryResource dr = new DirectoryResource();
StorageResource dnaStore = new StorageResource();
for (File f : dr.selectedFiles()) {
FileResource fr = new FileResource(f);
String s = fr.asString();
dnaStore = storeAll(s);
printGenes(dnaStore);
}
System.out.println("size = " + dnaStore.size());
}
public String readStrFromFile(){
FileResource readFile = new FileResource();
String DNA = readFile.asString();
//System.out.println("DNA: " + DNA);
return DNA;
}//end readStrFromFile() method;
public float calCGRatio(String gene){
gene = gene.toUpperCase();
int len = gene.length();
int CGCount = 0;
for(int i=0; i<len; i++){
if(gene.charAt(i) == 'C' || gene.charAt(i) == 'G')
CGCount++;
}//end for loop
System.out.println("CGCount " + CGCount + " Length: " + len + " Ratio: " + (float)CGCount/len);
return (float)CGCount/len;
}//end of calCGRatio() method;
public void printGenes(StorageResource sr){
//create a FindMultiGenesFile object FMG
FindMultiGenes5 FMG = new FindMultiGenes5();
//read a DNA sequence from file
String dna = FMG.readStrFromFile();
String geneList = FMG.storeAll(dna);
//store all genes into a document
StorageResource dnaStore = new StorageResource();
System.out.println("\n There are " + geneList.size() + " genes. ");
int longerthan60 = 0;
int CGGreaterthan35 = 0;
for(int i=0; i<geneList.size(); i++){
if(!dnaStore.contains(geneList.get(i)))
dnaStore.add(geneList.get(i));
if(geneList.get(i).length() > 60) longerthan60++;
if(FMG.calCGRatio(geneList.get(i)) > 0.35) CGGreaterthan35++;
}
System.out.println("dnaStore.size: " + dnaStore.size());
System.out.println("\n There are " + dnaStore.size() + " genes. ");
System.out.println("There are " + longerthan60 + " genes longer than 60.");
System.out.println("There are " + CGGreaterthan35 + " genes with CG ratio greater than 0.35.");
}//end main();
}

I found your post as I am also doing a similar course at Duke using those edu.duke libraries.
When I get that error message it is because I'm using the wrong method to access it.
Try FMD.data() to get an iterable of all of the gene strings.

The program throws NullPointerException [closed]

Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 8 years ago.
Improve this question
Not sure why it gives me the NullPointerException. Please help.
I am pretty sure all the arrays are full, and i restricted all the loops not to go passed empty spaces.
import java.util.;
import java.io.;
public class TextAnalysis {
public static void main (String [] args) throws IOException {
String fileName = args[0];
File file = new File(fileName);
Scanner fileScanner = new Scanner(file);
int MAX_WORDS = 10000;
String[] words = new String[MAX_WORDS];
int unique = 0;
System.out.println("TEXT FILE STATISTICS");
System.out.println("--------------------");
System.out.println("Length of the longest word: " + longestWord(fileScanner));
read(words, fileName);
System.out.println("Number of words in file wordlist: " + wordList(words));
System.out.println("Number of words in file: " + countWords(fileName) + "\n");
System.out.println("Word-frequency statistics");
lengthFrequency(words);
System.out.println();
System.out.println("Wordlist dump:");
wordFrequency(words,fileName);
}
public static void wordFrequency(String[] words, String fileName) throws IOException{
File file = new File(fileName);
Scanner s = new Scanner(file);
int [] array = new int [words.length];
while(s.hasNext()) {
String w = s.next();
if(w!=null){
for(int i = 0; i < words.length; i++){
if(w.equals(words[i])){
array[i]++;
}
}
for(int i = 0; i < words.length; i++){
System.out.println(words[i] + ":" + array[i]);
}
}
}
}
public static void lengthFrequency (String [] words) {
int [] lengthTimes = new int[10];
for(int i = 0; i < words.length; i++) {
String w = words[i];
if(w!=null){
if(w.length() >= 10) {
lengthTimes[9]++;
} else {
lengthTimes[w.length()-1]++;
}
}
}
for(int j = 0; j < 10; j++) {
System.out.println("Word-length " + (j+1) + ": " + lengthTimes[j]);
}
}
public static String longestWord (Scanner s) {
String longest = "";
while (s.hasNext()) {
String word = s.next();
if (word.length() > longest.length()) {
longest = word;
}
}
return (longest.length() + " " + "(\"" + longest + "\")");
}
public static int countWords (String fileName) throws IOException {
File file = new File(fileName);
Scanner fileScanner = new Scanner(file);
int count = 0;
while(fileScanner.hasNext()) {
String word = fileScanner.next();
count++;
}
return count;
}
public static void read(String[] words, String fileName) throws IOException{
File file = new File(fileName);
Scanner s = new Scanner(file);
while (s.hasNext()) {
String word = s.next();
int i;
for ( i=0; i < words.length && words[i] != null; i++ ) {
words[i]=words[i].toLowerCase();
if (words[i].equals(word)) {
break;
}
}
words[i] = word;
}
}
public static int wordList(String[] words) {
int count = 0;
while (words[count] != null) {
count++;
}
return count;
}
}

There are two problems with this code
1.You didn't do null check,although the array contains null values
2.Your array index from 0-8,if you wan't to get element at 9th index it will throw ArrayIndexOutOfBound Exception.
Your code should be like that
public static void lengthFrequency (String [] words) {
int [] lengthTimes = new int [9];
for(int i = 0; i < words.length; i++) {
String w = words[i];
if(null!=w) //This one added for null check
{
/* if(w.length() >= 10) {
lengthTimes[9]++;
} else {
lengthTimes[w.length()-1]++;
}
}*/
//Don't need to check like that ...u can do like below
for(int i = 0; i < words.length; i++) {
String w = words[i];
if(null!=w)
{
lengthTimes[i] =w.length();
}
}
}
//here we should traverse upto length of the array.
for(int i = 0; i < lengthTimes.length; i++) {
System.out.println("Word-length " + (i+1) + ": " + lengthTimes[i]);
}
}

Your String Array String[] words = new String[MAX_WORDS]; is not initialized,you are just declaring it.All its content is null,calling length method in line 31 will give you null pointer exception.
`

Simple mistake. When you declare an array, it is from size 0 to n-1. This array only has indexes from 0 to 8.
int [] lengthTimes = new int [9];
//some code here
lengthTimes[9]++; // <- this is an error (this is line 29)
for(int i = 0; i < 10; i++) {
System.out.println("Word-length " + (i+1) + ": " + lengthTimes[i]); // <- same error when i is 9. This is line 37

When you declare:
String[] words = new String[MAX_WORDS];
You're creating an array with MAX_WORDS of nulls, if your input file don't fill them all, you'll get a NullPointerException at what I think is line 37 in your original file:
if(w.length() >= 10) { // if w is null this would throw Npe
To fix it you may use a List instead:
List<String> words = new ArrayList<String>();
...
words.add( aWord );
Or perhaps you can use a Set if you don't want to have repeated words.

Sentence comparison with NLP

I used lingpipe for sentence detection but I don't have any idea if there is a better tool. As far as I have understood, there is no way to compare two sentences and see if they mean the same thing.
Is there anyother good source where I can have a pre-built method for comparing two sentences and see if they are similar?
My requirement is as below:
String sent1 = "Mary and Meera are my classmates.";
String sent2 = "Meera and Mary are my classmates.";
String sent3 = "I am in Meera and Mary's class.";
// several sentences will be formed and basically what I need to do is
// this
boolean bothAreEqual = compareOf(sent1, sent2);
sop(bothAreEqual); // should print true
boolean bothAreEqual = compareOf(sent2, sent3);
sop(bothAreEqual);// should print true

How to test if the meaning of two sentences are the same: this would be a too open-ended question.
However, there are methods for comparing two sentences and see if they are similar. There are many possible definition for similarity that can be tested with pre-built methods.
See for example http://en.wikipedia.org/wiki/Levenshtein_distance
Distance between
'Mary and Meera are my classmates.'
and 'Meera and Mary are my classmates.':
6
Distance between
'Mary and Meera are my classmates.'
and 'Alice and Bobe are not my classmates.':
14
Distance between
'Mary and Meera are my classmates.'
and 'Some totally different sentence.':
29
code:
public class LevenshteinDistance {
private static int minimum(int a, int b, int c) {
return Math.min(Math.min(a, b), c);
}
public static int computeDistance(CharSequence str1,
CharSequence str2) {
int[][] distance = new int[str1.length() + 1][str2.length() + 1];
for (int i = 0; i <= str1.length(); i++){
distance[i][0] = i;
}
for (int j = 0; j <= str2.length(); j++){
distance[0][j] = j;
}
for (int i = 1; i <= str1.length(); i++){
for (int j = 1; j <= str2.length(); j++){
distance[i][j] = minimum(
distance[i - 1][j] + 1,
distance[i][j - 1] + 1,
distance[i - 1][j - 1]
+ ((str1.charAt(i - 1) == str2.charAt(j - 1)) ? 0 : 1));
}
}
int result = distance[str1.length()][str2.length()];
//log.debug("distance:"+result);
return result;
}
public static void main(String[] args) {
String sent1="Mary and Meera are my classmates.";
String sent2="Meera and Mary are my classmates.";
String sent3="Alice and Bobe are not my classmates.";
String sent4="Some totally different sentence.";
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent2+"': \n"+computeDistance(sent1, sent2));
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent3+"': \n"+computeDistance(sent1, sent3));
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent4+"': \n"+computeDistance(sent1, sent4));
}
}

Here is wat i have come up with. this is just a substitute till i get to the real thing but it might be of some help to people out there..
package com.examples;
import java.io.File;
import java.io.FileNotFoundException;
import java.io.IOException;
import java.util.ArrayList;
import java.util.List;
import com.aliasi.sentences.MedlineSentenceModel;
import com.aliasi.sentences.SentenceModel;
import com.aliasi.tokenizer.IndoEuropeanTokenizerFactory;
import com.aliasi.tokenizer.Tokenizer;
import com.aliasi.tokenizer.TokenizerFactory;
import com.aliasi.util.Files;
import com.sun.accessibility.internal.resources.accessibility;
public class SentenceWordAnalysisAndLevenshteinDistance {
private static int minimum(int a, int b, int c) {
return Math.min(Math.min(a, b), c);
}
public static int computeDistance(CharSequence str1, CharSequence str2) {
int[][] distance = new int[str1.length() + 1][str2.length() + 1];
for (int i = 0; i <= str1.length(); i++) {
distance[i][0] = i;
}
for (int j = 0; j <= str2.length(); j++) {
distance[0][j] = j;
}
for (int i = 1; i <= str1.length(); i++) {
for (int j = 1; j <= str2.length(); j++) {
distance[i][j] = minimum(
distance[i - 1][j] + 1,
distance[i][j - 1] + 1,
distance[i - 1][j - 1]
+ ((str1.charAt(i - 1) == str2.charAt(j - 1)) ? 0
: 1));
}
}
int result = distance[str1.length()][str2.length()];
return result;
}
static final TokenizerFactory TOKENIZER_FACTORY = IndoEuropeanTokenizerFactory.INSTANCE;
static final SentenceModel SENTENCE_MODEL = new MedlineSentenceModel();
public static void main(String[] args) {
try {
ArrayList<String> sentences = null;
sentences = new ArrayList<String>();
// Reading from text file
// sentences = readSentencesInFile("D:\\sam.txt");
// Giving sentences
// ArrayList<String> sentences = new ArrayList<String>();
sentences.add("Mary and Meera are my classmates.");
sentences.add("Mary and Meera are my classmates.");
sentences.add("Meera and Mary are my classmates.");
sentences.add("Alice and Bobe are not my classmates.");
sentences.add("Some totally different sentence.");
// Self-implemented
wordAnalyser(sentences);
// Internet referred
// levenshteinDistance(sentences);
} catch (Exception e) {
// TODO: handle exception
e.printStackTrace();
}
}
private static ArrayList<String> readSentencesInFile(String path) {
ArrayList<String> sentencesList = new ArrayList<String>();
try {
System.out.println("Reading file from : " + path);
File file = new File(path);
String text = Files.readFromFile(file, "ISO-8859-1");
System.out.println("INPUT TEXT: ");
System.out.println(text);
List<String> tokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(
text.toCharArray(), 0, text.length());
tokenizer.tokenize(tokenList, whiteList);
System.out.println(tokenList.size() + " TOKENS");
System.out.println(whiteList.size() + " WHITESPACES");
String[] tokens = new String[tokenList.size()];
String[] whites = new String[whiteList.size()];
tokenList.toArray(tokens);
whiteList.toArray(whites);
int[] sentenceBoundaries = SENTENCE_MODEL.boundaryIndices(tokens,
whites);
System.out.println(sentenceBoundaries.length
+ " SENTENCE END TOKEN OFFSETS");
if (sentenceBoundaries.length < 1) {
System.out.println("No sentence boundaries found.");
return new ArrayList<String>();
}
int sentStartTok = 0;
int sentEndTok = 0;
for (int i = 0; i < sentenceBoundaries.length; ++i) {
sentEndTok = sentenceBoundaries[i];
System.out.println("SENTENCE " + (i + 1) + ": ");
StringBuffer sentenceString = new StringBuffer();
for (int j = sentStartTok; j <= sentEndTok; j++) {
sentenceString.append(tokens[j] + whites[j + 1]);
}
System.out.println(sentenceString.toString());
sentencesList.add(sentenceString.toString());
sentStartTok = sentEndTok + 1;
}
} catch (IOException e) {
// TODO: handle exception
e.printStackTrace();
}
return sentencesList;
}
private static void levenshteinDistance(ArrayList<String> sentences) {
System.out.println("\nLevenshteinDistance");
for (int i = 0; i < sentences.size(); i++) {
System.out.println("Distance between \n'" + sentences.get(0)
+ "' \nand '" + sentences.get(i) + "': \n"
+ computeDistance(sentences.get(0),
sentences.get(i)));
}
}
private static void wordAnalyser(ArrayList<String> sentences) {
System.out.println("No.of Sentences : " + sentences.size());
List<String> stopWordsList = getStopWords();
List<String> tokenList = new ArrayList<String>();
ArrayList<List<String>> filteredSentences = new ArrayList<List<String>>();
for (int i = 0; i < sentences.size(); i++) {
tokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(sentences.get(i)
.toCharArray(), 0, sentences.get(i).length());
tokenizer.tokenize(tokenList, whiteList);
System.out.print("Sentence " + (i + 1) + ": " + tokenList.size()
+ " TOKENS, ");
System.out.println(whiteList.size() + " WHITESPACES");
filteredSentences.add(filterStopWords(tokenList, stopWordsList));
}
for (int i = 0; i < sentences.size(); i++) {
System.out.println("\n" + (i + 1) + ". Comparing\n '"
+ sentences.get(0) + "' \nwith\n '" +
sentences.get(i)
+ "' : \n");
System.out.println(filteredSentences.get(0) + "\n and \n"
+ filteredSentences.get(i));
System.out.println("Percentage of similarity: "
+ calculateSimilarity(filteredSentences.get(0),
filteredSentences.get(i))
+ "%");
}
}
private static double calculateSimilarity(List<String> list1,
List<String> list2) {
int length1 = list1.size();
int length2 = list2.size();
int count1 = 0;
int count2 = 0;
double result1 = 0.0;
double result2 = 0.0;
int least, highest;
if (length2 > length1) {
least = length1;
highest = length2;
} else {
least = length2;
highest = length1;
}
// computing result1
for (String string1 : list1) {
if (list2.contains(string1))
count1++;
}
result1 = (count1 * 100) / length1;
// computing result2
for (String string2 : list2) {
if (list1.contains(string2))
count2++;
}
result2 = (count2 * 100) / length2;
double avg = (result1 + result2) / 2;
return avg;
}
private static List<String> getStopWords() {
String stopWordsString = ".,a,able,about,across,after,all,almost,also,am,among,an,and,any,are,as,at,be,because,been,but,by,can,cannot,could,dear,did,do,does,either,else,ever,every,for,from,get,got,had,has,have,he,her,hers,him,his,how,however,i,if,in,into,is,it,its,just,least,let,like,likely,may,me,might,most,must,my,neither,no,nor,not,of,off,often,on,only,or,other,our,own,rather,said,say,says,she,should,since,so,some,than,that,the,their,them,then,there,these,they,this,tis,to,too,twas,us,wants,was,we,were,what,when,where,which,while,who,whom,why,will,with,would,yet,you,your";
List<String> stopWordsList = new ArrayList<String>();
List<String> stopWordTokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(
stopWordsString.toCharArray(), 0, stopWordsString.length());
tokenizer.tokenize(stopWordTokenList, whiteList);
for (int i = 0; i < stopWordTokenList.size(); i++) {
// System.out.println((i + 1) + ":" + tokenList.get(i));
if (!stopWordTokenList.get(i).equals(",")) {
stopWordsList.add(stopWordTokenList.get(i));
}
}
System.out.println("No.of stop words: " + stopWordsList.size());
return stopWordsList;
}
private static List<String> filterStopWords(List<String> tokenList,
List<String> stopWordsList) {
List<String> filteredSentenceWords = new ArrayList<String>();
for (String sentenceToken : tokenList) {
if (!stopWordsList.contains(sentenceToken)) {
filteredSentenceWords.add(sentenceToken);
}
}
return filteredSentenceWords;
}
}

Loading contact from phone book in J2ME

I implemented this code below in order to read contacts from the addressbook of the phone
The problem is, In a case when all the numbers in the phonebook are saved in the SIM it reads and displays the contacts for selection.
But in a case whereby any number is included on the phone memory, it gives an application error.(OutOfMemoryException)
What do I do (PS do not mind some System.out.println statements there. I used them for debugging)
public void execute() {
try {
// go through all the lists
String[] allContactLists = PIM.getInstance().listPIMLists(PIM.CONTACT_LIST);
if (allContactLists.length != 0) {
for (int i = 0; i < allContactLists.length; i++) {
System.out.println(allContactLists[i] + " " + allContactLists[1]);
System.out.println(allContactLists.length);
loadNames(allContactLists[i]);
System.out.println("Execute() error");
}
} else {
available = false;
}
} catch (PIMException e) {
available = false;
} catch (SecurityException e) {
available = false;
}
}
private void loadNames(String name) throws PIMException, SecurityException {
ContactList contactList = null;
try {
// ----
// System.out.println("loadErr1");
contactList = (ContactList) PIM.getInstance().openPIMList(PIM.CONTACT_LIST, PIM.READ_ONLY, name);
// System.out.println(contactList.getName());//--Phone Contacts or Sim Contacts
// First check that the fields we are interested in are supported(MODULARIZE)
if (contactList.isSupportedField(Contact.FORMATTED_NAME)
&& contactList.isSupportedField(Contact.TEL)) {
// ContactLst.append("Reading contacts...", null);
// System.out.println("sup1");
Enumeration items = contactList.items();
// System.out.println("sup2");
Vector telNumbers = new Vector();
telNames = new Vector();
while (items.hasMoreElements()) {
Contact contact = (Contact) items.nextElement();
int telCount = contact.countValues(Contact.TEL);
int nameCount = contact.countValues(Contact.FORMATTED_NAME);
// System.out.println(telCount);
// System.out.println(nameCount);
// we're only interested in contacts with a phone number
// nameCount should always be > 0 since FORMATTED_NAME is
// mandatory
if (telCount > 0 && nameCount > 0) {
String contactName = contact.getString(Contact.FORMATTED_NAME, 0);
// go through all the phone numbers
for (int i = 0; i < telCount; i++) {
System.out.println("Read Telno");
int telAttributes = contact.getAttributes(Contact.TEL, i);
String telNumber = contact.getString(Contact.TEL, i);
System.out.println(telNumber + " " + "tel");
// check if ATTR_MOBILE is supported
if (contactList.isSupportedAttribute(Contact.TEL, Contact.ATTR_MOBILE)) {
if ((telAttributes & Contact.ATTR_MOBILE) != 0) {
telNames.insertElementAt(telNames, i);
telNumbers.insertElementAt(telNumber, i);
} else {
telNumbers.addElement(telNumber);
telNames.addElement(telNames);
}
}
// else {
//// telNames.addElement(contactName);
// telNumbers.addElement(telNumber);
// }
System.out.println("telephone nos");
}
// Shorten names which are too long
shortenName(contactName, 20);
for (int i = 0; i <= telNumbers.size(); i++) {
System.out.println(contactName + " here " + telNames.size());
telNames.addElement(contactName);
System.out.println(telNames.elementAt(i) + " na " + i);
}
names = new String[telNames.size()];
for (int j = 0; j < names.length; j++) {
names[j] = (String) telNames.elementAt(j);
System.out.println(names[j] + "....");
}
// allTelNames.addElement(telNames);
System.out.println("cap :" + telNames.size() + " " + names.length);
// telNames.removeAllElements();
// telNumbers.removeAllElements();
}
}
available = true;
} else {
// ContactLst.append("Contact list required items not supported", null);
available = false;
}
} finally {
// always close it
if (contactList != null) {
contactList.close();
}
}
}

Develop Reference

Java is a programming language and computing platform first released by Sun Microsystems in 1995.

Using scanner to read file and group data - java

Related

Problem with reading textfiles with scanner in Java and ArrayLists

Error message for StorageResource type

The program throws NullPointerException [closed]

Sentence comparison with NLP

Loading contact from phone book in J2ME

Categories

Resources