Develop Reference

Parse string containing javascript

I have a string:
2 + 2 = ${2 + 2}
This is a ${"string"}
This is an object: ${JSON.stringify({a: "B"})}
This should be "<something>": ${{
abc: "def",
cba: {
arr: [
"<something>"
]
}
}.cba.arr[0]}
This should ${"${also work}"}
And after parsing it I should get something like that:
2 + 2 = 4
This is a string
This is an object: {"a":"B"}
This should be "<something>": <something>
This should ${also work}
So I need help implementing it in Java, I simply need to get what is between ${ and }.
I tried using a regular expression: \${(.+?)} but it fails when string inside contains }

So after a bit of testing, I've ended up with this:
ScriptEngine scriptEngine = new ScriptEngineManager(null).getEngineByName("JavaScript");
String str = "2 + 2 = ${2 + 2}\n" +
"This is a ${\"string\"}\n" +
"This is an object: ${JSON.stringify({a: \"B\"})}\n" +
"This should be \"F\": ${var test = {\n" +
" a : {\n" +
" c : \"F\"\n" +
" }\n" +
"};\n" +
"test.a.c\n" +
"}\n" +
"This should ${\"${also work}\"}"; // String to be parsed
StringBuffer result = new StringBuffer();
boolean dollarSign = false;
int bracketsOpen = 0;
int beginIndex = -1;
int lastEndIndex = 0;
char[] chars = str.toCharArray();
for(int i = 0; i < chars.length; i++) { // i is for index
char c = chars[i];
if(dollarSign) {
if(c == '{') {
if(beginIndex == -1) {
beginIndex = i + 1;
}
bracketsOpen++;
} else if(c == '}') {
if(bracketsOpen > 0) {
bracketsOpen--;
}
if(bracketsOpen <= 0) {
int endIndex = i;
String evalResult = ""; // evalResult is the replacement value
try {
evalResult = scriptEngine.eval(str.substring(beginIndex, endIndex)).toString(); // Using script engine as an example; str.substring(beginIndex, endIndex) is used to get string between ${ and }
} catch (ScriptException e) {
e.printStackTrace();
}
result.append(str.substring(lastEndIndex, beginIndex - 2));
result.append(evalResult);
lastEndIndex = endIndex + 1;
dollarSign = false;
beginIndex = -1;
bracketsOpen = 0;
}
} else {
dollarSign = false;
}
} else {
if(c == '$') {
dollarSign = true;
}
}
}
result.append(str.substring(lastEndIndex));
System.out.println(result.toString());

Final 2D-Array data getting altered without implicitly changing its value using Java

I am currently facing an issue regarding this method getSurroundingSumGrid() which is supposed to take data from an earlier grid that was built based off of text file data and use it to determine new values within the array sumGrid. The STATICGRID array gets built at first with the correct values but then as the for loop continues on, the STATICGRID values change to what i have set sumGrid to change to. I don't have any defined code where STATICGRID is ever set to equal another value and if I did it should give an error.
public double[][] getSurroundingSumGrid() {
this.sumGrid = getBaseGrid();
for (int rowNum = 0; rowNum < sumGrid.length; rowNum++) {
final double[][] STATICGRID = this.getBaseGrid();
double topNum = 0, botNum = 0, rightNum = 0, leftNum = 0;
for (int colNum = 0; colNum < sumGrid[0].length; colNum++) {
try {
topNum = STATICGRID[rowNum - 1][colNum];
System.out.println("TOPNUM : (" + (rowNum-1) + "," + colNum + ") " + STATICGRID[rowNum-1][colNum]);
} catch (Exception e) {
topNum = STATICGRID[rowNum][colNum];
System.out.println("Top IndexOutOfBoundsException: " + STATICGRID[rowNum][colNum] + " used instead.");
}
try {
botNum = STATICGRID[rowNum + 1][colNum];
System.out.println("BOTNUM : (" + (rowNum+1) + "," + colNum + ") " + STATICGRID[rowNum+1][colNum]);
} catch (Exception e) {
botNum = STATICGRID[rowNum][colNum];
System.out.println("Bot IndexOutOfBoundsException: " + STATICGRID[rowNum][colNum] + " used instead.");
}
try {
leftNum = STATICGRID[rowNum][colNum - 1];
System.out.println("LEFTNUM : (" + rowNum + "," + (colNum-1) + ") " + STATICGRID[rowNum][colNum-1]);
} catch (Exception e) {
leftNum = STATICGRID[rowNum][colNum];
System.out.println("Left IndexOutOfBoundsException: " + STATICGRID[rowNum][colNum] + " used instead.");
}
try {
rightNum = STATICGRID[rowNum][colNum + 1];
System.out.println("RIGHTNUM : (" + rowNum + "," + (colNum+1) + ") " + STATICGRID[rowNum][colNum+1]);
} catch (Exception e) {
rightNum = STATICGRID[rowNum][colNum];
System.out.println("Right IndexOutOfBoundsException: " + STATICGRID[rowNum][colNum] + " used instead.");
}
this.sumGrid[rowNum][colNum] = topNum + botNum + rightNum + leftNum;
System.out.println("STATICGRID NEW NUM : " + STATICGRID[rowNum][colNum]);
System.out.println("SUMGRID NEW NUM : " + sumGrid[rowNum][colNum]);
}
}
return this.sumGrid;
}
When doing these tests with the code I can see very clearly that the data in both arrays are changing overtime, and in turn giving me wrong results. I've tried for about 2 hours just moving things around and can't seem to figure out how to get this to work properly.
As you can even see, I even attempted rebuilding the STATICGRID array every single time the for loop completed and it wouldn't even hinder the result. It does the same thing regardless of where you put the STATICGRID at (either outside or inside at the top-most level of the for loop, and it doesn't matter whether it's final or not), it does the same thing. After looking at it for so long I'm beyond confused on why my code isn't working and I have a slight feeling that it is the try-catch statement but I wouldn't at all know why. I don't know a ton about the statement and what it does entirely but the reason it is there is because the data can get an IndexOutOfBoundsException so instead of getting that it would instead count itself for each IndexOutOfBoundsException it got as per the assignment instructions.
Thanks and I hope this makes sense.

Alright, thanks to FredK's suggestion at using a deepCopy, I did some research and used this method to get better results. This is the unoptomizedDeepCopy by Philip Isehour. I don't exactly understand it but I'm going to just use it for now and spend some time learning more about this and how they work. I'm currently a CS221 student and we haven't gone over deepCopy yet.
public static Object deepCopy(Object orig) {
Object obj = null;
try {
// Write the object out to a byte array
ByteArrayOutputStream bos = new ByteArrayOutputStream();
ObjectOutputStream out = new ObjectOutputStream(bos);
out.writeObject(orig);
out.flush();
out.close();
// Make an input stream from the byte array and read
// a copy of the object back in.
ObjectInputStream in = new ObjectInputStream(
new ByteArrayInputStream(bos.toByteArray()));
obj = in.readObject();
}
catch(IOException e) {
e.printStackTrace();
}
catch(ClassNotFoundException cnfe) {
cnfe.printStackTrace();
}
return obj;
}
After this method, I then was able to stop the array from changing value by using this in front of the getBaseGrid() method.
public double[][] getSurroundingSumGrid() {
this.sumGrid = (double[][]) GridMonitor.deepCopy(this.getBaseGrid());
double[][] staticGrid = (double[][]) GridMonitor.deepCopy(this.getBaseGrid());
double topNum, botNum, rightNum, leftNum;
for (int rowNum = 0; rowNum < sumGrid.length; rowNum++) {
for (int colNum = 0; colNum < sumGrid[0].length; colNum++) {
try {
topNum = staticGrid[rowNum - 1][colNum];
} catch (Exception e) {
topNum = staticGrid[rowNum][colNum];
}
try {
botNum = staticGrid[rowNum + 1][colNum];
} catch (Exception e) {
botNum = staticGrid[rowNum][colNum];
}
try {
leftNum = staticGrid[rowNum][colNum - 1];
} catch (Exception e) {
leftNum = staticGrid[rowNum][colNum];
}
try {
rightNum = staticGrid[rowNum][colNum + 1];
} catch (Exception e) {
rightNum = staticGrid[rowNum][colNum];
}
this.sumGrid[rowNum][colNum] = topNum + botNum + rightNum + leftNum;
}
}
return this.sumGrid;
}
Thanks!

Java Syntax Checker using java.util.stack

I have an assignment with regards to making a Java syntax checker. It is using java.util.stack, and what it's supposed to do is read from a file that's provided and then check for syntax errors. How it is supposed to do this is by adding a 'token' to the stack that has the character, line number, position in the line, whether it's unmatched or unexpected and the line itself.
The code for the function is as follows:
public static boolean check(String Filename, boolean ConsoleOutput) throws FileNotFoundException
{
mFileName = Filename;
mConsoleOutput = ConsoleOutput;
File mFile = new File("src/Kurien/tests/" + mFileName);
Scanner FileReader = new Scanner(mFile);
if(ConsoleOutput)
{
System.out.println("Processing " + "'" + mFileName + "'" + "\n" + "----------------------");
}
while (FileReader.hasNextLine())
{
mLineNumber++;
mLine = FileReader.nextLine();
for (int counter = 0; counter < mLine.length(); counter++)
{
mCharacter = mLine.charAt(counter);
if (mCharacter == '(')
{
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unmatched, mLine));
}
else if (mCharacter == '{')
{
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unmatched, mLine));
}
else if (mCharacter == ')')
{
if (mStack.isEmpty())
{
Error = true;
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unexpected, mLine));
}
else if (mStack.peek().equals('('))
{
mStack.pop();
}
else
{
Error = true;
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unexpected, mLine));
}
}
else if (mCharacter == '}')
{
if (mStack.isEmpty())
{
Error = true;
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unexpected, mLine));
}
else if (mStack.peek().equals('{'))
{
mStack.pop();
}
else
{
Error = true;
mStack.push(new Token(mCharacter, mLineNumber, counter, ErrorDetail.Unexpected,mLine));
}
}
}
}
if(!Error)
{
System.out.println("[SUCCESS]");
}
else
{
while(mStack.iterator().hasNext())
{
Token Temp = (Token)mStack.iterator().next();
if(Temp.mDetail == ErrorDetail.Unexpected)
{
System.out.println("[ERROR] " + Temp.mDetail.toString() + " closing token in file '" + mFileName + "'" + " line#" + Temp.mLineNumber);
System.out.println(mLine);
System.out.println(Spaces(Temp.mLine.length() - Temp.mPosition) + "^");
}
else if(Temp.mDetail == ErrorDetail.Unmatched)
{
System.out.println("[ERROR] + " + Temp.mDetail + "token in file '" + mFileName + "'" + "line#" + Temp.mLineNumber);
System.out.println(mLine);
System.out.println(Spaces(Temp.mLine.length() - Temp.mPosition) + "^");
}
}
}
return Error;
}
private static class Token
{
char mCharacter;
int mLineNumber;
int mPosition;
ErrorDetail mDetail;
String mLine;
Token(char Character, int LineNumber, int Position, ErrorDetail Detail, String Line)
{
mCharacter = Character;
mLineNumber = LineNumber;
mPosition = Position;
mDetail = Detail;
mLine = Line;
}
}
}
Now, the expected output for the first test case is as follows:
[ERROR] Unexpected closing token in file 'test1.txt' line#7:
}
^
However all I get is the following:
[ERROR] + Unmatchedtoken in file 'test1.txt'line#1
I know the formatting could be fine tuned, however there is clearly another problem here that I just can't quite put my finger on.

Error message for StorageResource type

I've been trying to work on this problem for a while now but to no avail. When I run the code I get this error message: incompatible types: edu.duke.StorageResource cannot be converted to java.lang.String on line String geneList = FMG.storeAll(dna);. Does this mean I'm trying to make edu.duke object work with a java.lang.String type object? What would we go about resolving this issue?
Here's my code so far:
package coursera_java_duke;
import java.io.*;
import edu.duke.FileResource;
import edu.duke.StorageResource;
import edu.duke.DirectoryResource;
public class FindMultiGenes5 {
public int findStopIndex(String dna, int index) {
int stop1 = dna.indexOf("TGA", index);
if (stop1 == -1 || (stop1 - index) % 3 != 0) {
stop1 = dna.length();
}
int stop2 = dna.indexOf("TAA", index);
if (stop2 == -1 || (stop2 - index) % 3 != 0) {
stop2 = dna.length();
}
int stop3 = dna.indexOf("TAG", index);
if (stop3 == -1 || (stop3 - index) % 3 != 0) {
stop3 = dna.length();
}
return Math.min(stop1, Math.min(stop2, stop3));
}
public StorageResource storeAll(String dna) {
//CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCAdna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA";
String geneAL = new String();
String sequence = dna.toUpperCase();
StorageResource store = new StorageResource();
int index = 0;
while (true) {
index = sequence.indexOf("ATG", index);
if (index == -1)
break;
int stop = findStopIndex(sequence, index + 3);
if (stop != sequence.length()) {
String gene = dna.substring(index, stop + 3);
store.add(gene);
//index = sequence.substring(index, stop + 3).length();
index = stop + 3; // start at the end of the stop codon
}else{ index = index + 3;
}
}
return store;//System.out.println(sequence);
}
public void testStorageFinder() {
DirectoryResource dr = new DirectoryResource();
StorageResource dnaStore = new StorageResource();
for (File f : dr.selectedFiles()) {
FileResource fr = new FileResource(f);
String s = fr.asString();
dnaStore = storeAll(s);
printGenes(dnaStore);
}
System.out.println("size = " + dnaStore.size());
}
public String readStrFromFile(){
FileResource readFile = new FileResource();
String DNA = readFile.asString();
//System.out.println("DNA: " + DNA);
return DNA;
}//end readStrFromFile() method;
public float calCGRatio(String gene){
gene = gene.toUpperCase();
int len = gene.length();
int CGCount = 0;
for(int i=0; i<len; i++){
if(gene.charAt(i) == 'C' || gene.charAt(i) == 'G')
CGCount++;
}//end for loop
System.out.println("CGCount " + CGCount + " Length: " + len + " Ratio: " + (float)CGCount/len);
return (float)CGCount/len;
}//end of calCGRatio() method;
public void printGenes(StorageResource sr){
//create a FindMultiGenesFile object FMG
FindMultiGenes5 FMG = new FindMultiGenes5();
//read a DNA sequence from file
String dna = FMG.readStrFromFile();
String geneList = FMG.storeAll(dna);
//store all genes into a document
StorageResource dnaStore = new StorageResource();
System.out.println("\n There are " + geneList.size() + " genes. ");
int longerthan60 = 0;
int CGGreaterthan35 = 0;
for(int i=0; i<geneList.size(); i++){
if(!dnaStore.contains(geneList.get(i)))
dnaStore.add(geneList.get(i));
if(geneList.get(i).length() > 60) longerthan60++;
if(FMG.calCGRatio(geneList.get(i)) > 0.35) CGGreaterthan35++;
}
System.out.println("dnaStore.size: " + dnaStore.size());
System.out.println("\n There are " + dnaStore.size() + " genes. ");
System.out.println("There are " + longerthan60 + " genes longer than 60.");
System.out.println("There are " + CGGreaterthan35 + " genes with CG ratio greater than 0.35.");
}//end main();
}

I found your post as I am also doing a similar course at Duke using those edu.duke libraries.
When I get that error message it is because I'm using the wrong method to access it.
Try FMD.data() to get an iterable of all of the gene strings.

Why is my jpql .getResultList() returning 0 rows for a good query

I was using the exact same query yesterday and it was working fine today I made a few changes to flow of the program and the query no longer returns and rows.
the first function that my programs goes to:
public void prepareSummary(Date startDate , Date endDate)
{
int getStartDay = getDayFromDate(startDate);
int getStartMonth = getMonthFromDate(startDate);
//
int getEndDay = getDayFromDate(endDate);
int getEndMonth = getMonthFromDate(endDate);
int getYear = getYearFromDate(startDate);
if(getStartMonth <= getEndMonth)
{
if(getStartMonth == getEndMonth)
{
if(getStartDay < getEndDay)
{
while(getStartDay <= getEndDay)
{
Calendar cal = Calendar.getInstance();
cal.set( getYear, getStartMonth, getStartDay);
Date queryStart = getStartOfDay(cal.getTime());
Date queryEnd = getEndOfDay(cal.getTime());
List<Object[]> res = getSumList(queryStart, queryEnd);
doQuery(res);
++getStartDay;
}
}
else
{
}
}
else
{
}
}
else
{
}
}
Here is what getSumList looks like:
public List<Object[]> getSumList(Date start, Date end) {
String query = "";
query += "SELECT COUNT(s) pCount,"
+ "p.nameText,"
+ "g.nameText,"
+ "t.shiftID"
+ " FROM Sheets s , GradeNames g , SpecieNames p, ShiftTimes t"
+ " WHERE s.createdLocal > :start and s.createdLocal < :end"
+ " AND s.specieNameIndex = p.nameIndex "
+ " AND s.gradeNameIndex = g.nameIndex"
+ " AND s.shiftIndex = t.shiftIndex"
+ " GROUP BY p.nameText , g.nameText , t.shiftID";
Query q = em.createQuery(query);
q.setParameter("start", start);
q.setParameter("end", end);
return q.getResultList();
}
This next function doesn't matter at this point because nothing is being executed because the list length is zero:
private void doQuery(List<Object[]> obj)
{
int length = obj.size();
String grade = null;
Long standingCount = (long) 0;
System.out.println("Length" + length);
for (int i = 0; i < length; ++i) {
// HAVE A LIST OF ALL ITEMS PULLED FROM DATABASE
Object[] tmpObj = obj.get(i);
Long tmpCount = (Long) tmpObj[0];
String tmpSpecieName = (String) tmpObj[1];
Double tmpThickness = Double.parseDouble(getSpecie().getThicknessFromSpecie(tmpSpecieName));
String tmpLength = getSpecie().getLengthFromSpecie(tmpSpecieName);
String tmpGradeName = (String) tmpObj[2];
String tmpShift = (String) tmpObj[3];
tmpSpecieName = getSpecie().getSpecieFromSpecie(tmpSpecieName);
//// END OF ALL ITEMS PULLED FROM DATABASE
if (grade != pullGradeName(tmpGradeName) && grade != null) {
System.out.println("Count:" + standingCount + "Grade:" + tmpGradeName + "--" + "Specie" + tmpSpecieName + "Shift:" + tmpShift + "Thickness:" + tmpThickness + "Length:" + tmpLength + "SpecieNAme:" + tmpSpecieName);
// do previous insert
grade = pullGradeName(tmpGradeName);
} else if (grade != pullGradeName(tmpGradeName) && grade == null) {
grade = pullGradeName(tmpGradeName);
} else if (grade == pullGradeName(tmpGradeName)) {
standingCount = standingCount + tmpCount;
}
System.out.println("Count:" + tmpCount + "Grade:" + tmpGradeName + "--" + "Specie" + tmpSpecieName + "Shift:" + tmpShift + "Thickness:" + tmpThickness + "Length:" + tmpLength + "SpecieNAme:" + tmpSpecieName);
}
}

Check the SQL that is generated, and the tables you are querying over. As the query requires inner joins, if one of the tables was cleared, it would return no results. If you want to get a 0 count, you need to use an outer join syntax which isn't possible in JPA unless you use object level mappings:
"SELECT COUNT(s) pCount,"
+ "p.nameText,"
+ "g.nameText,"
+ "t.shiftID"
+ " FROM Sheets s outer join s.specialNameIndex p,"
+ " outer join s.gradeNameIndex g, outer join s.shiftIndex t"
+ " WHERE s.createdLocal > :start and s.createdLocal < :end"
+ " GROUP BY p.nameText , g.nameText , t.shiftID";