Develop Reference

Apply LOOCV in java splitting with a specific condition

I have a csv file containing 24231 rows. I would like to apply LOOCV based on the project name instead of the observations of the whole dataset.
So if my dataset contains information for 15 projects, I would like to have the training set based on 14 projects and the test set based on the other project.
I was relying on weka's API, is there anything that automates this process?

For non-numeric attributes, Weka allows you to retrieve the unique values via Attribute.numValues() (how many are there) and Attribute.value(int) (the -th value).
package weka;
import weka.core.Attribute;
import weka.core.Instance;
import weka.core.Instances;
import weka.core.converters.ConverterUtils;
public class LOOByValue {
/**
* 1st arg: ARFF file to load
* 2nd arg: 0-based index in ARFF to use for class
* 3rd arg: 0-based index in ARFF to use for LOO
*
* #param args the command-line arguments
* #throws Exception if loading/processing of data fails
*/
public static void main(String[] args) throws Exception {
// load data
Instances full = ConverterUtils.DataSource.read(args[0]);
full.setClassIndex(Integer.parseInt(args[1]));
int looCol = Integer.parseInt(args[2]);
Attribute looAtt = full.attribute(looCol);
if (looAtt.isNumeric())
throw new IllegalStateException("Attribute cannot be numeric!");
// iterate unique values to create train/test splits
for (int i = 0; i < looAtt.numValues(); i++) {
String value = looAtt.value(i);
System.out.println("\n" + (i+1) + "/" + full.attribute(looCol).numValues() + ": " + value);
Instances train = new Instances(full, full.numInstances());
Instances test = new Instances(full, full.numInstances());
for (int n = 0; n < full.numInstances(); n++) {
Instance inst = full.instance(n);
if (inst.stringValue(looCol).equals(value))
test.add((Instance) inst.copy());
else
train.add((Instance) inst.copy());
}
train.compactify();
test.compactify();
// TODO do something with the data
System.out.println("train size: " + train.numInstances());
System.out.println("test size: " + test.numInstances());
}
}
}
With Weka's anneal UCI dataset and the surface-quality for leave-one-out, you can generate something like this:
1/5: ?
train size: 654
test size: 244
2/5: D
train size: 843
test size: 55
3/5: E
train size: 588
test size: 310
4/5: F
train size: 838
test size: 60
5/5: G
train size: 669
test size: 229

How to LocalDateTime but use server time or internet time? [duplicate]

I would like to get the GMT [ Greenwich Mean Time ], and also I don't want to rely on my system date time for that. Basically, I want to use time sync server like in.pool.ntp.org [ India ] for GMT calculation, or may be I am going in wrong direction!
How to do this in java ?
Is there any java library to get time from Time server?

sp0d is not quite right:
timeInfo.getReturnTime(); // Returns time at which time message packet was received by local machine
So it just returns current system time, not the received one. See TimeInfo man page.
You should use
timeInfo.getMessage().getTransmitTimeStamp().getTime();
instead.
So the code block will be:
String TIME_SERVER = "time-a.nist.gov";
NTPUDPClient timeClient = new NTPUDPClient();
InetAddress inetAddress = InetAddress.getByName(TIME_SERVER);
TimeInfo timeInfo = timeClient.getTime(inetAddress);
long returnTime = timeInfo.getMessage().getTransmitTimeStamp().getTime();
Date time = new Date(returnTime);

Here is a code i found somewhere else.. and i am using it. Uses apache commons library.
List of time servers: NIST Internet Time Service
import java.net.InetAddress;
import java.util.Date;
import org.apache.commons.net.ntp.NTPUDPClient;
import org.apache.commons.net.ntp.TimeInfo;
public class TimeLookup {
public static void main() throws Exception {
String TIME_SERVER = "time-a.nist.gov";
NTPUDPClient timeClient = new NTPUDPClient();
InetAddress inetAddress = InetAddress.getByName(TIME_SERVER);
TimeInfo timeInfo = timeClient.getTime(inetAddress);
long returnTime = timeInfo.getReturnTime();
Date time = new Date(returnTime);
System.out.println("Time from " + TIME_SERVER + ": " + time);
}
}
Returns the output
Time from time-d.nist.gov: Sun Nov 25 06:04:34 IST 2012

I know this is an old question but I notice that all the answers are not correct or are complicated.
A nice and simple way to implement it is using Apache Commons Net library. This library will provide a NTPUDPClient class to manage connectionless NTP requests. This class will return a TimeInfo instance. This object should run the compute method to calculate the offset between your system's time and the NTP server's time. Lets try to implement it here
Add the Apache Commons Net library to your project.
<dependency>
<groupId>commons-net</groupId>
<artifactId>commons-net</artifactId>
<version>3.6</version>
</dependency>
Create a new instance of the NTPUDPClient class.
Setup the default timeout
Get the InetAddress of the NTP Server.
Call the NTPUDPClient.getTime() method to retrieve a TimeInfo instance with the time information from the specified server.
Call the computeDetails() method to compute and validate details of the NTP message packet.
Finally, get a NTP timestamp object based on a Java time by using this code TimeStamp.getNtpTime(currentTime + offset).getTime().
Here we have a basic implementation:
import java.net.InetAddress;
import java.util.Date;
import org.apache.commons.net.ntp.NTPUDPClient;
import org.apache.commons.net.ntp.TimeInfo;
public class NTPClient {
private static final String SERVER_NAME = "pool.ntp.org";
private volatile TimeInfo timeInfo;
private volatile Long offset;
public static void main() throws Exception {
NTPUDPClient client = new NTPUDPClient();
// We want to timeout if a response takes longer than 10 seconds
client.setDefaultTimeout(10_000);
InetAddress inetAddress = InetAddress.getByName(SERVER_NAME);
TimeInfo timeInfo = client.getTime(inetAddress);
timeInfo.computeDetails();
if (timeInfo.getOffset() != null) {
this.timeInfo = timeInfo;
this.offset = timeInfo.getOffset();
}
// This system NTP time
TimeStamp systemNtpTime = TimeStamp.getCurrentTime();
System.out.println("System time:\t" + systemNtpTime + " " + systemNtpTime.toDateString());
// Calculate the remote server NTP time
long currentTime = System.currentTimeMillis();
TimeStamp atomicNtpTime = TimeStamp.getNtpTime(currentTime + offset).getTime()
System.out.println("Atomic time:\t" + atomicNtpTime + " " + atomicNtpTime.toDateString());
}
public boolean isComputed()
{
return timeInfo != null && offset != null;
}
}
You will get something like that:
System time: dfaa2c15.2083126e Thu, Nov 29 2018 18:12:53.127
Atomic time: dfaa2c15.210624dd Thu, Nov 29 2018 18:12:53.129

This link demonstrates a java class called NtpMessage.java that you can paste into your program which will fetch the current time from an NTP server.
At the following link, Find the "Attachment" section near the bottom and download NtpMessage.java and SntpClient.java and paste it into your java application. It will do all the work and fetch you the time.
http://support.ntp.org/bin/view/Support/JavaSntpClient
Copy and paste of the code if it goes down:
import java.text.DecimalFormat;
import java.text.SimpleDateFormat;
import java.util.Date;
/**
* This class represents a NTP message, as specified in RFC 2030. The message
* format is compatible with all versions of NTP and SNTP.
*
* This class does not support the optional authentication protocol, and
* ignores the key ID and message digest fields.
*
* For convenience, this class exposes message values as native Java types, not
* the NTP-specified data formats. For example, timestamps are
* stored as doubles (as opposed to the NTP unsigned 64-bit fixed point
* format).
*
* However, the contructor NtpMessage(byte[]) and the method toByteArray()
* allow the import and export of the raw NTP message format.
*
*
* Usage example
*
* // Send message
* DatagramSocket socket = new DatagramSocket();
* InetAddress address = InetAddress.getByName("ntp.cais.rnp.br");
* byte[] buf = new NtpMessage().toByteArray();
* DatagramPacket packet = new DatagramPacket(buf, buf.length, address, 123);
* socket.send(packet);
*
* // Get response
* socket.receive(packet);
* System.out.println(msg.toString());
*
*
* This code is copyright (c) Adam Buckley 2004
*
* This program is free software; you can redistribute it and/or modify it
* under the terms of the GNU General Public License as published by the Free
* Software Foundation; either version 2 of the License, or (at your option)
* any later version. A HTML version of the GNU General Public License can be
* seen at http://www.gnu.org/licenses/gpl.html
*
* This program is distributed in the hope that it will be useful, but WITHOUT
* ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
* FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
* more details.
*
*
* Comments for member variables are taken from RFC2030 by David Mills,
* University of Delaware.
*
* Number format conversion code in NtpMessage(byte[] array) and toByteArray()
* inspired by http://www.pps.jussieu.fr/~jch/enseignement/reseaux/
* NTPMessage.java which is copyright (c) 2003 by Juliusz Chroboczek
*
* #author Adam Buckley
*/
public class NtpMessage
{
/**
* This is a two-bit code warning of an impending leap second to be
* inserted/deleted in the last minute of the current day. It's values
* may be as follows:
*
* Value Meaning
* ----- -------
* 0 no warning
* 1 last minute has 61 seconds
* 2 last minute has 59 seconds)
* 3 alarm condition (clock not synchronized)
*/
public byte leapIndicator = 0;
/**
* This value indicates the NTP/SNTP version number. The version number
* is 3 for Version 3 (IPv4 only) and 4 for Version 4 (IPv4, IPv6 and OSI).
* If necessary to distinguish between IPv4, IPv6 and OSI, the
* encapsulating context must be inspected.
*/
public byte version = 3;
/**
* This value indicates the mode, with values defined as follows:
*
* Mode Meaning
* ---- -------
* 0 reserved
* 1 symmetric active
* 2 symmetric passive
* 3 client
* 4 server
* 5 broadcast
* 6 reserved for NTP control message
* 7 reserved for private use
*
* In unicast and anycast modes, the client sets this field to 3 (client)
* in the request and the server sets it to 4 (server) in the reply. In
* multicast mode, the server sets this field to 5 (broadcast).
*/
public byte mode = 0;
/**
* This value indicates the stratum level of the local clock, with values
* defined as follows:
*
* Stratum Meaning
* ----------------------------------------------
* 0 unspecified or unavailable
* 1 primary reference (e.g., radio clock)
* 2-15 secondary reference (via NTP or SNTP)
* 16-255 reserved
*/
public short stratum = 0;
/**
* This value indicates the maximum interval between successive messages,
* in seconds to the nearest power of two. The values that can appear in
* this field presently range from 4 (16 s) to 14 (16284 s); however, most
* applications use only the sub-range 6 (64 s) to 10 (1024 s).
*/
public byte pollInterval = 0;
/**
* This value indicates the precision of the local clock, in seconds to
* the nearest power of two. The values that normally appear in this field
* range from -6 for mains-frequency clocks to -20 for microsecond clocks
* found in some workstations.
*/
public byte precision = 0;
/**
* This value indicates the total roundtrip delay to the primary reference
* source, in seconds. Note that this variable can take on both positive
* and negative values, depending on the relative time and frequency
* offsets. The values that normally appear in this field range from
* negative values of a few milliseconds to positive values of several
* hundred milliseconds.
*/
public double rootDelay = 0;
/**
* This value indicates the nominal error relative to the primary reference
* source, in seconds. The values that normally appear in this field
* range from 0 to several hundred milliseconds.
*/
public double rootDispersion = 0;
/**
* This is a 4-byte array identifying the particular reference source.
* In the case of NTP Version 3 or Version 4 stratum-0 (unspecified) or
* stratum-1 (primary) servers, this is a four-character ASCII string, left
* justified and zero padded to 32 bits. In NTP Version 3 secondary
* servers, this is the 32-bit IPv4 address of the reference source. In NTP
* Version 4 secondary servers, this is the low order 32 bits of the latest
* transmit timestamp of the reference source. NTP primary (stratum 1)
* servers should set this field to a code identifying the external
* reference source according to the following list. If the external
* reference is one of those listed, the associated code should be used.
* Codes for sources not listed can be contrived as appropriate.
*
* Code External Reference Source
* ---- -------------------------
* LOCL uncalibrated local clock used as a primary reference for
* a subnet without external means of synchronization
* PPS atomic clock or other pulse-per-second source
* individually calibrated to national standards
* ACTS NIST dialup modem service
* USNO USNO modem service
* PTB PTB (Germany) modem service
* TDF Allouis (France) Radio 164 kHz
* DCF Mainflingen (Germany) Radio 77.5 kHz
* MSF Rugby (UK) Radio 60 kHz
* WWV Ft. Collins (US) Radio 2.5, 5, 10, 15, 20 MHz
* WWVB Boulder (US) Radio 60 kHz
* WWVH Kaui Hawaii (US) Radio 2.5, 5, 10, 15 MHz
* CHU Ottawa (Canada) Radio 3330, 7335, 14670 kHz
* LORC LORAN-C radionavigation system
* OMEG OMEGA radionavigation system
* GPS Global Positioning Service
* GOES Geostationary Orbit Environment Satellite
*/
public byte[] referenceIdentifier = {0, 0, 0, 0};
/**
* This is the time at which the local clock was last set or corrected, in
* seconds since 00:00 1-Jan-1900.
*/
public double referenceTimestamp = 0;
/**
* This is the time at which the request departed the client for the
* server, in seconds since 00:00 1-Jan-1900.
*/
public double originateTimestamp = 0;
/**
* This is the time at which the request arrived at the server, in seconds
* since 00:00 1-Jan-1900.
*/
public double receiveTimestamp = 0;
/**
* This is the time at which the reply departed the server for the client,
* in seconds since 00:00 1-Jan-1900.
*/
public double transmitTimestamp = 0;
/**
* Constructs a new NtpMessage from an array of bytes.
*/
public NtpMessage(byte[] array)
{
// See the packet format diagram in RFC 2030 for details
leapIndicator = (byte) ((array[0] >> 6) & 0x3);
version = (byte) ((array[0] >> 3) & 0x7);
mode = (byte) (array[0] & 0x7);
stratum = unsignedByteToShort(array[1]);
pollInterval = array[2];
precision = array[3];
rootDelay = (array[4] * 256.0) +
unsignedByteToShort(array[5]) +
(unsignedByteToShort(array[6]) / 256.0) +
(unsignedByteToShort(array[7]) / 65536.0);
rootDispersion = (unsignedByteToShort(array[8]) * 256.0) +
unsignedByteToShort(array[9]) +
(unsignedByteToShort(array[10]) / 256.0) +
(unsignedByteToShort(array[11]) / 65536.0);
referenceIdentifier[0] = array[12];
referenceIdentifier[1] = array[13];
referenceIdentifier[2] = array[14];
referenceIdentifier[3] = array[15];
referenceTimestamp = decodeTimestamp(array, 16);
originateTimestamp = decodeTimestamp(array, 24);
receiveTimestamp = decodeTimestamp(array, 32);
transmitTimestamp = decodeTimestamp(array, 40);
}
/**
* Constructs a new NtpMessage in client -> server mode, and sets the
* transmit timestamp to the current time.
*/
public NtpMessage()
{
// Note that all the other member variables are already set with
// appropriate default values.
this.mode = 3;
this.transmitTimestamp = (System.currentTimeMillis()/1000.0) + 2208988800.0;
}
/**
* This method constructs the data bytes of a raw NTP packet.
*/
public byte[] toByteArray()
{
// All bytes are automatically set to 0
byte[] p = new byte[48];
p[0] = (byte) (leapIndicator << 6 | version << 3 | mode);
p[1] = (byte) stratum;
p[2] = (byte) pollInterval;
p[3] = (byte) precision;
// root delay is a signed 16.16-bit FP, in Java an int is 32-bits
int l = (int) (rootDelay * 65536.0);
p[4] = (byte) ((l >> 24) & 0xFF);
p[5] = (byte) ((l >> 16) & 0xFF);
p[6] = (byte) ((l >> 8) & 0xFF);
p[7] = (byte) (l & 0xFF);
// root dispersion is an unsigned 16.16-bit FP, in Java there are no
// unsigned primitive types, so we use a long which is 64-bits
long ul = (long) (rootDispersion * 65536.0);
p[8] = (byte) ((ul >> 24) & 0xFF);
p[9] = (byte) ((ul >> 16) & 0xFF);
p[10] = (byte) ((ul >> 8) & 0xFF);
p[11] = (byte) (ul & 0xFF);
p[12] = referenceIdentifier[0];
p[13] = referenceIdentifier[1];
p[14] = referenceIdentifier[2];
p[15] = referenceIdentifier[3];
encodeTimestamp(p, 16, referenceTimestamp);
encodeTimestamp(p, 24, originateTimestamp);
encodeTimestamp(p, 32, receiveTimestamp);
encodeTimestamp(p, 40, transmitTimestamp);
return p;
}
/**
* Returns a string representation of a NtpMessage
*/
public String toString()
{
String precisionStr =
new DecimalFormat("0.#E0").format(Math.pow(2, precision));
return "Leap indicator: " + leapIndicator + "\n" +
"Version: " + version + "\n" +
"Mode: " + mode + "\n" +
"Stratum: " + stratum + "\n" +
"Poll: " + pollInterval + "\n" +
"Precision: " + precision + " (" + precisionStr + " seconds)\n" +
"Root delay: " + new DecimalFormat("0.00").format(rootDelay*1000) + " ms\n" +
"Root dispersion: " + new DecimalFormat("0.00").format(rootDispersion*1000) + " ms\n" +
"Reference identifier: " + referenceIdentifierToString(referenceIdentifier, stratum, version) + "\n" +
"Reference timestamp: " + timestampToString(referenceTimestamp) + "\n" +
"Originate timestamp: " + timestampToString(originateTimestamp) + "\n" +
"Receive timestamp: " + timestampToString(receiveTimestamp) + "\n" +
"Transmit timestamp: " + timestampToString(transmitTimestamp);
}
/**
* Converts an unsigned byte to a short. By default, Java assumes that
* a byte is signed.
*/
public static short unsignedByteToShort(byte b)
{
if((b & 0x80)==0x80) return (short) (128 + (b & 0x7f));
else return (short) b;
}
/**
* Will read 8 bytes of a message beginning at <code>pointer</code>
* and return it as a double, according to the NTP 64-bit timestamp
* format.
*/
public static double decodeTimestamp(byte[] array, int pointer)
{
double r = 0.0;
for(int i=0; i<8; i++)
{
r += unsignedByteToShort(array[pointer+i]) * Math.pow(2, (3-i)*8);
}
return r;
}
/**
* Encodes a timestamp in the specified position in the message
*/
public static void encodeTimestamp(byte[] array, int pointer, double timestamp)
{
// Converts a double into a 64-bit fixed point
for(int i=0; i<8; i++)
{
// 2^24, 2^16, 2^8, .. 2^-32
double base = Math.pow(2, (3-i)*8);
// Capture byte value
array[pointer+i] = (byte) (timestamp / base);
// Subtract captured value from remaining total
timestamp = timestamp - (double) (unsignedByteToShort(array[pointer+i]) * base);
}
// From RFC 2030: It is advisable to fill the non-significant
// low order bits of the timestamp with a random, unbiased
// bitstring, both to avoid systematic roundoff errors and as
// a means of loop detection and replay detection.
array[7] = (byte) (Math.random()*255.0);
}
/**
* Returns a timestamp (number of seconds since 00:00 1-Jan-1900) as a
* formatted date/time string.
*/
public static String timestampToString(double timestamp)
{
if(timestamp==0) return "0";
// timestamp is relative to 1900, utc is used by Java and is relative
// to 1970
double utc = timestamp - (2208988800.0);
// milliseconds
long ms = (long) (utc * 1000.0);
// date/time
String date = new SimpleDateFormat("dd-MMM-yyyy HH:mm:ss").format(new Date(ms));
// fraction
double fraction = timestamp - ((long) timestamp);
String fractionSting = new DecimalFormat(".000000").format(fraction);
return date + fractionSting;
}
/**
* Returns a string representation of a reference identifier according
* to the rules set out in RFC 2030.
*/
public static String referenceIdentifierToString(byte[] ref, short stratum, byte version)
{
// From the RFC 2030:
// In the case of NTP Version 3 or Version 4 stratum-0 (unspecified)
// or stratum-1 (primary) servers, this is a four-character ASCII
// string, left justified and zero padded to 32 bits.
if(stratum==0 || stratum==1)
{
return new String(ref);
}
// In NTP Version 3 secondary servers, this is the 32-bit IPv4
// address of the reference source.
else if(version==3)
{
return unsignedByteToShort(ref[0]) + "." +
unsignedByteToShort(ref[1]) + "." +
unsignedByteToShort(ref[2]) + "." +
unsignedByteToShort(ref[3]);
}
// In NTP Version 4 secondary servers, this is the low order 32 bits
// of the latest transmit timestamp of the reference source.
else if(version==4)
{
return "" + ((unsignedByteToShort(ref[0]) / 256.0) +
(unsignedByteToShort(ref[1]) / 65536.0) +
(unsignedByteToShort(ref[2]) / 16777216.0) +
(unsignedByteToShort(ref[3]) / 4294967296.0));
}
return "";
}
}

The server time-a.nist.gov does not list the time port; you have to use correct server ntp.xs4all.nl for getting date and time from internet:
String TIME_SERVER = "ntp.xs4all.nl";
//... some other code

R wrapper for a java method in a jar using rjava

I am trying to access a java program MELTING 5 in R using the rjava package.
I can do it using the system function as follows using the batch file.
path <- "path/to/melting.bat"
sequence = "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCCAC"
hybridisation.type = "dnadna"
OligomerConc = 5e-8
Sodium = 0.05
command=paste("-S", sequence,
"-H", hybridisation.type,
"-P", OligomerConc,
"-E", paste("Na=", Sodium, sep = ""))
system(paste("melting.bat", command))
I am trying to do the same using a wrapper, following the steps in hellowjavaworld without any success.
.jaddClassPath('path/to/melting5.jar')
main <- .jnew("melting/Main")
out <- .jcall(obj = main, returnSig = "V", method = "main", .jarray(list(), "java/lang/String"),
argument = command)
The java code in melting/Main.java in the melting5.jar that I am trying to access is as follows.
package melting;
import java.text.NumberFormat;
import melting.configuration.OptionManagement;
import melting.configuration.RegisterMethods;
import melting.methodInterfaces.MeltingComputationMethod;
import melting.nearestNeighborModel.NearestNeighborMode;
/**
* The Melting main class which contains the public static void main(String[] args) method.
*/
public class Main {
// private static methods
/**
* Compute the entropy, enthalpy and the melting temperature and display the results.
* #param args : contains the options entered by the user.
* #param OptionManagement optionManager : the OptionManegement which allows to manage
* the different options entered by the user.
*/
private static ThermoResult runMelting(String [] args, OptionManagement optionManager){
try {
ThermoResult results =
getMeltingResults(args, optionManager);
displaysMeltingResults(results);
return results;
} catch (Exception e) {
OptionManagement.logError(e.getMessage());
return null;
}
}
/**
* Compute the entropy, enthalpy and melting temperature, and return
* these results.
* #param args options (entered by the user) that determine the
* sequence, hybridization type and other features of the
* environment.
* #param optionManager the {#link
* melting.configuration.OptionManagement
* <code>OptionManagement</code>} which
* allows the program to manage the different
* options entered by the user.
* #return The results of the Melting computation.
*/
public static ThermoResult getMeltingResults(String[] args,
OptionManagement optionManager)
{
NumberFormat format = NumberFormat.getInstance();
format.setMaximumFractionDigits(2);
// Set up the environment from the supplied arguments and get the
// results.
Environment environment = optionManager.createEnvironment(args);
RegisterMethods register = new RegisterMethods();
MeltingComputationMethod calculMethod =
register.getMeltingComputationMethod(environment.getOptions());
ThermoResult results = calculMethod.computesThermodynamics();
results.setCalculMethod(calculMethod);
environment.setResult(results);
// Apply corrections to the results.
results = calculMethod.getRegister().
computeOtherMeltingCorrections(environment);
environment.setResult(results);
return environment.getResult();
}
/**
* displays the results of Melting : the computed enthalpy and entropy (in cal/mol and J/mol), and the computed
* melting temperature (in degrees).
* #param results : the ThermoResult containing the computed enthalpy, entropy and
* melting temperature
* #param MeltingComputationMethod calculMethod : the melting computation method (Approximative or nearest neighbor computation)
*/
private static void displaysMeltingResults(ThermoResult results)
{
NumberFormat format = NumberFormat.getInstance();
format.setMaximumFractionDigits(2);
MeltingComputationMethod calculMethod =
results.getCalculMethod();
double enthalpy = results.getEnthalpy();
double entropy = results.getEntropy();
OptionManagement.logInfo("\n The MELTING results are : ");
if (calculMethod instanceof NearestNeighborMode){
OptionManagement.logInfo("Enthalpy : " + format.format(enthalpy) + " cal/mol ( " + format.format(results.getEnergyValueInJ(enthalpy)) + " J /mol)");
OptionManagement.logInfo("Entropy : " + format.format(entropy) + " cal/mol-K ( " + format.format(results.getEnergyValueInJ(entropy)) + " J /mol-K)");
}
OptionManagement.logInfo("Melting temperature : " + format.format(results.getTm()) + " degrees C.\n");
}
// public static main method
/**
* #param args : contains the options entered by the user.
*/
public static void main(String[] args) {
OptionManagement optionManager = new OptionManagement();
if (args.length == 0){
optionManager.initialiseLogger();
optionManager.readMeltingHelp();
}
else if (optionManager.isMeltingInformationOption(args)){
try {
optionManager.readOptions(args);
} catch (Exception e) {
OptionManagement.logError(e.getMessage());
}
}
else {
runMelting(args, optionManager);
}
}
}
How to pass arguments in command to public static void main in java jar?

Over at https://github.com/hrbrmstr/melting5jars I made a pkg wrapper for the MELTING 5 jar (melting5.jar) and also put the Data/ directory in it so you don't have to deal with jar-file management. It can be installed via devtools::install_github("hrbrmstr/melting5jars"),
BEFORE you load that library, you need to set the NN_PATH since the Data/ dir is not where the jar expects it to be by default and you may run into issues setting it afterwards (YMMV).
NOTE: I don't work with this Java library and am not in your field, so please double check the results with the command-line you're used to running!
So, the first things to do to try to get this to work are:
Sys.setenv("NN_PATH"=system.file("extdata", "Data", package="melting5jars"))
library(melting5jars) # devtools::install_github("hrbrmstr/melting5jars")
Now, one of the cooler parts of rJava is that you get to work in R (code) if you want to vs Java (code). We can recreate the core parts of that Main class right in R.
First, get a new melting.Main object and a new OptionManagement object just like the Java code does:
melting <- new(J("melting.Main"))
optionManager <- new(J("melting.configuration.OptionManagement"))
Next, we setup your options. I left Sodium the way it is just to ensure I didn't mess anything up.
Sodium <- 0.05
opts <- c(
"-S", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCCAC",
"-H", "dnadna",
"-P", 5e-8,
"-E", paste("Na=", Sodium, sep = "")
)
Now, we can call getMeltingResults() from that Main class directly:
results <- melting$getMeltingResults(opts, optionManager)
and then perform the same calls on those results:
calculMethod <- results$getCalculMethod()
enthalpy <- results$getEnthalpy()
entropy <- results$getEntropy()
if (.jinstanceof(calculMethod, J("melting.nearestNeighborModel.NearestNeighborMode"))) {
enthalpy <- results$getEnergyValueInJ(enthalpy)
entropy <- results$getEnergyValueInJ(entropy)
}
melting_temperature <- results$getTm()
enthalpy
## [1] -1705440
entropy
## [1] -4566.232
melting_temperature
## [1] 72.04301
We can wrap all that up into a function that will make it easier to call in the future:
get_melting_results <- function(opts = c()) {
stopifnot(length(opts) > 2) # a sanity check that could be improved
Sys.setenv("NN_PATH"=system.file("extdata", "Data", package="melting5jars"))
require(melting5jars)
melting <- new(J("melting.Main"))
optionManager <- new(J("melting.configuration.OptionManagement"))
results <- melting$getMeltingResults(opts, optionManager)
calculMethod <- results$getCalculMethod()
enthalpy_cal <- results$getEnthalpy()
entropy_cal <- results$getEntropy()
enthalpy_J <- entropy_J <- NULL
if (.jinstanceof(calculMethod, J("melting.nearestNeighborModel.NearestNeighborMode"))) {
enthalpy_J <- results$getEnergyValueInJ(enthalpy_cal)
entropy_J <- results$getEnergyValueInJ(entropy_cal)
}
melting_temp_C <- results$getTm()
list(
enthalpy_cal = enthalpy_cal,
entropy_cal = entropy_cal,
enthalpy_J = enthalpy_J,
entropy_J = entropy_J,
melting_temp_C = melting_temp_C
) -> out
class(out) <- c("melting_res")
out
}
That also has separate values for enthalpy and entropy depending on the method result.
We can also make a print helper function since we classed the list() we're returning:
print.melting_res <- function(x, ...) {
cat(
"The MELTING results are:\n\n",
" - Enthalpy: ", prettyNum(x$enthalpy_cal), " cal/mol",
{if (!is.null(x$enthalpy_J)) paste0(" (", prettyNum(x$enthalpy_J), " J /mol)", collapse="") else ""}, "\n",
" - Entropy: ", prettyNum(x$entropy_cal), " cal/mol-K",
{if (!is.null(x$entropy_J)) paste0(" (", prettyNum(x$entropy_J), " J /mol-K)", collapse="") else ""}, "\n",
" - Meltng temperature: ", prettyNum(x$melting_temp_C), " degress C\n",
sep=""
)
}
(I made an assumption you're used to seeing the MELTING 5 command line output)
And, finally, re-run the computation:
Sodium <- 0.05
opts <- c(
"-S", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCCAC",
"-H", "dnadna",
"-P", 5e-8,
"-E", paste("Na=", Sodium, sep = "")
)
res <- get_melting_results(opts)
res
## The MELTING results are:
##
## - Enthalpy: -408000 cal/mol (-1705440 J /mol)
## - Entropy: -1092.4 cal/mol-K (-4566.232 J /mol-K)
## - Meltng temperature: 72.04301 degress C
str(res)
## List of 5
## $ enthalpy_cal : num -408000
## $ entropy_cal : num -1092
## $ enthalpy_J : num -1705440
## $ entropy_J : num -4566
## $ melting_temp_C: num 72
## - attr(*, "class")= chr "melting_res"
You should be able to use the above methodology to wrap other components (if any) in the MELTING library.

Weka output predictions

I've used the Weka GUI for training and testing a file (making predictions), but can't do the same with the API. The error I'm getting says there's a different number of attributes in the train and test files. In the GUI, this can be solved by checking "Output predictions".
How to do something similar using the API? do you know of any samples out there?
import weka.classifiers.bayes.NaiveBayes;
import weka.classifiers.meta.FilteredClassifier;
import weka.classifiers.trees.J48;
import weka.core.Instances;
import weka.core.converters.ConverterUtils.DataSource;
import weka.filters.Filter;
import weka.filters.unsupervised.attribute.NominalToBinary;
import weka.filters.unsupervised.attribute.Remove;
public class WekaTutorial
{
public static void main(String[] args) throws Exception
{
DataSource trainSource = new DataSource("/tmp/classes - edited.arff"); // training
Instances trainData = trainSource.getDataSet();
DataSource testSource = new DataSource("/tmp/classes_testing.arff");
Instances testData = testSource.getDataSet();
if (trainData.classIndex() == -1)
{
trainData.setClassIndex(trainData.numAttributes() - 1);
}
if (testData.classIndex() == -1)
{
testData.setClassIndex(testData.numAttributes() - 1);
}
String[] options = weka.core.Utils.splitOptions("weka.filters.unsupervised.attribute.StringToWordVector -R first-last -W 1000 -prune-rate -1.0 -N 0 -stemmer weka.core.stemmers.NullStemmer -M 1 "
+ "-tokenizer \"weka.core.tokenizers.WordTokenizer -delimiters \" \\r\\n\\t.,;:\\\'\\\"()?!\"");
Remove remove = new Remove();
remove.setOptions(options);
remove.setInputFormat(trainData);
NominalToBinary filter = new NominalToBinary();
NaiveBayes nb = new NaiveBayes();
FilteredClassifier fc = new FilteredClassifier();
fc.setFilter(filter);
fc.setClassifier(nb);
// train and make predictions
fc.buildClassifier(trainData);
for (int i = 0; i < testData.numInstances(); i++)
{
double pred = fc.classifyInstance(testData.instance(i));
System.out.print("ID: " + testData.instance(i).value(0));
System.out.print(", actual: " + testData.classAttribute().value((int) testData.instance(i).classValue()));
System.out.println(", predicted: " + testData.classAttribute().value((int) pred));
}
}
}
Error:
Exception in thread "main" java.lang.IllegalArgumentException: Src and Dest differ in # of attributes: 2 != 17152
This was not an issue for the GUI.

You need to ensure that categories in train and test sets are compatible, try to
combine train and test sets
List item
preprocess them
save them as arff
open two empty files
copy the header from the top to line "#data"
copy in training set into first file and test set into second file

Java: SimpleDateFormat timestamp not updating

Evening,
I'm trying to create a timestamp for when an entity is added to my PriorityQueue using the following SimpleDate format: [yyyy/MM/dd - hh:mm:ss a] (Samples of results below)
Nano-second precision NOT 100% necessary
1: 2012/03/09 - 09:58:36 PM
Do you know how I can maintain an 'elapsed time' timestamp that shows when customers have been added to the PriorityQueue?
In the StackOverflow threads I've come across, most say to use System.nanoTime(); although I can't find resources online to implement this into a SimpleDateFormat. I have also consulted with colleagues.
Also, I apologize for not using syntax highlighting (if S.O supports it)
Code excerpt [unused methods omitted]:
<!-- language: java -->
package grocerystoresimulation;
/*****************************************************************************
* #import
*/
import java.util.PriorityQueue;
import java.util.Random;
import java.util.ArrayList;
import java.util.Date;
import java.text.DateFormat;
import java.text.SimpleDateFormat;
/************************************************************************************
public class GroceryStoreSimulation {
/************************************************************************************
* #fields
*/
private PriorityQueue<Integer> pq = new PriorityQueue<Integer>();
private Random rand = new Random(); //instantiate new Random object
private Date date = new Date();
private DateFormat dateFormat = new SimpleDateFormat("yyyy/MM/dd - hh:mm:ss a");
private ArrayList<String> timeStamp = new ArrayList<String>(); //store timestamps
private int customersServed; //# of customers served during simulation
/************************************************************************************
* #constuctor
*/
public GroceryStoreSimulation(){
System.out.println("Instantiated new GroceryStoreSimulation # ["
+ dateFormat.format(date) + "]\n" + insertDivider());
//Program body
while(true){
try{
Thread.sleep(generateWaitTime());
newCustomer(customersServed);
} catch(InterruptedException e){/*Catch 'em all*/}
}
}
/************************************************************************************
* #param String ID
*/
private void newCustomer(int ID){
System.out.println("Customer # " + customersServed + " added to queue. . .");
pq.offer(ID); //insert element into PriorityQueue
customersServed++;
assignArrivalTime(ID); //call assignArrivalTime() method
} //newCustomer()
/************************************************************************************
* #param String ID
*/
private void assignArrivalTime(int ID){
timeStamp.add(ID + ": " + dateFormat.format(date));
System.out.println(timeStamp.get(customersServed-1));
} //assignArrivalTime()
/************************************************************************************
* #return int
*/
private int generateWaitTime(){
//Local variables
int Low = 1000; //1000ms
int High = 4000; //4000ms
int waitTime = rand.nextInt(High-Low) + Low;
System.out.println("Delaying for: " + waitTime);
return waitTime;
}
//***********************************************************************************
private static String insertDivider(){
return ("******************************************************************");
}
//***********************************************************************************
} //GroceryStoreSimulation
Problem:
Timestamp does not update, only represents initial runtime (see below)
Delaying by 1-4 seconds w/Thread.sleep(xxx) (pseudo-randomly generated)
Problem may be in the assignArrivalTime() method
Output:
run:
Instantiated new GroceryStoreSimulation # [2012/03/09 - 09:58:36 PM]
******************************************************************
Delaying for: 1697
Customer # 0 added to queue. . .
0: 2012/03/09 - 09:58:36 PM
Delaying for: 3550
Customer # 1 added to queue. . .
1: 2012/03/09 - 09:58:36 PM
Delaying for: 2009
Customer # 2 added to queue. . .
2: 2012/03/09 - 09:58:36 PM
Delaying for: 1925
BUILD STOPPED (total time: 8 seconds)
Thank you for your assistance, I hope my question is clear enough & I`ve followed your formatting guidelines sufficiently.

You have to use a new instance of Date everytime to get most recent timestamp.
private void assignArrivalTime(int ID){
timeStamp.add(ID + ": " + dateFormat.format(date));
------------------------------------------------^^^^
Try replacing date by new Date() in above line.