Replace characters with substring using a loop Java

Replace characters with substring using a loop Java - java

I am trying to replace each instance of what is between two brackets using a loop and an array. array1a and array1b are the indices of where the brackets open and close. I want to get the number between the two brackets and increment it by one and replace the value currently there, but as the string text is currently a list (such as "list item (0) list item (10) list item (1023)" I want to use a loop to increment the value of each rather than to set all the values within brackets to the same value. I hope this makes sense!
String text = myString.getText();
for (int x = 0; x < 10; x++) {
array2[x] = text.substring(array1a[x], array1b[x]);
array2[x] = array2[x] + 1;
array3[x] = "(" + array2[x] + ")";
String text2 = text.replaceAll("\\(.*\\)", array3[x]);
myString.setText(text2);
}
Full Code:
public class CreateVideoList extends JFrame implements ActionListener {
JButton play = new JButton("Play Playlist");
JButton addVideo = new JButton("Add Video");
TextArea playlist = new TextArea(6, 50);
JTextField videoNo = new JTextField(2);
private int x = 0;
#Override
public void actionPerformed(ActionEvent e) {
String key = videoNo.getText();
String name = VideoData.getName(key);
String director = VideoData.getDirector(key);
Integer playCount = VideoData.getPlayCount(key);
String text = playlist.getText();
String rating = CheckVideos.stars(VideoData.getRating(key));
String output = name + " - " + director + "\nRating: "
+ rating
+ "\nPlay Count: " + playCount;
String newItem = key + " " + name + " - " + director + " ("
+ playCount + ") " + "\n";
String addToList = "";
String[] array3 = new String[100];
if ("Add Video".equals(e.getActionCommand())) {
if (Character.isDigit(text.charAt(0)) == false) {
playlist.setText("");
}
if (addToList.indexOf(key) == -1) {
addToList += addToList + newItem;
playlist.append(addToList);
array3[x] = key;
x++;
} else if (addToList.indexOf(key) != -1) {
JOptionPane.showMessageDialog(CreateVideoList.this,
"This video is already in the playlist. Please select a"
+ " different video.", "Add to playlist error", JOptionPane.INFORMATION_MESSAGE);
}
}
if ("Play Playlist".equals(e.getActionCommand())) {
Integer length = (text.length());
int counta = 0;
Integer[] array1a = new Integer[100];
Integer[] array1b = new Integer[100];
String strPlayCount = "";
for (x = 0; x < length; x++) {
if (text.charAt(x) == '(') {
counta++;
array1a[counta - 1] = x;
array1a[counta - 1] = array1a[counta - 1] + 1;
}
if (text.charAt(x) == ')') {
array1b[counta - 1] = x;
array1b[counta - 1] = array1b[counta - 1];
}
}
String[] array2 = new String[counta];
String[] array4 = new String[100];
for (int y = 0; y < counta; y++) {
array2[y] = text.substring(array1a[y], array1b[y]);
array2[y] = array2[y] + 1;
playCount = Integer.parseInt(array2[y]);
array4[y] = "(" + array2[y] + ")";
String text2 = text.replaceAll("\\(.*\\)", array4[y]);
playlist.setText(text2);
}
}
}

Replace
array2[x] = array2[x] + 1;
array3[x] = "(" + array2[x] + ")";
with
Integer n = Integer.parseInt(array2[x]) + 1;
array3[x] = "(" + n.toString() + ")";

Related

Error message for StorageResource type

I've been trying to work on this problem for a while now but to no avail. When I run the code I get this error message: incompatible types: edu.duke.StorageResource cannot be converted to java.lang.String on line String geneList = FMG.storeAll(dna);. Does this mean I'm trying to make edu.duke object work with a java.lang.String type object? What would we go about resolving this issue?
Here's my code so far:
package coursera_java_duke;
import java.io.*;
import edu.duke.FileResource;
import edu.duke.StorageResource;
import edu.duke.DirectoryResource;
public class FindMultiGenes5 {
public int findStopIndex(String dna, int index) {
int stop1 = dna.indexOf("TGA", index);
if (stop1 == -1 || (stop1 - index) % 3 != 0) {
stop1 = dna.length();
}
int stop2 = dna.indexOf("TAA", index);
if (stop2 == -1 || (stop2 - index) % 3 != 0) {
stop2 = dna.length();
}
int stop3 = dna.indexOf("TAG", index);
if (stop3 == -1 || (stop3 - index) % 3 != 0) {
stop3 = dna.length();
}
return Math.min(stop1, Math.min(stop2, stop3));
}
public StorageResource storeAll(String dna) {
//CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCAdna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA";
String geneAL = new String();
String sequence = dna.toUpperCase();
StorageResource store = new StorageResource();
int index = 0;
while (true) {
index = sequence.indexOf("ATG", index);
if (index == -1)
break;
int stop = findStopIndex(sequence, index + 3);
if (stop != sequence.length()) {
String gene = dna.substring(index, stop + 3);
store.add(gene);
//index = sequence.substring(index, stop + 3).length();
index = stop + 3; // start at the end of the stop codon
}else{ index = index + 3;
}
}
return store;//System.out.println(sequence);
}
public void testStorageFinder() {
DirectoryResource dr = new DirectoryResource();
StorageResource dnaStore = new StorageResource();
for (File f : dr.selectedFiles()) {
FileResource fr = new FileResource(f);
String s = fr.asString();
dnaStore = storeAll(s);
printGenes(dnaStore);
}
System.out.println("size = " + dnaStore.size());
}
public String readStrFromFile(){
FileResource readFile = new FileResource();
String DNA = readFile.asString();
//System.out.println("DNA: " + DNA);
return DNA;
}//end readStrFromFile() method;
public float calCGRatio(String gene){
gene = gene.toUpperCase();
int len = gene.length();
int CGCount = 0;
for(int i=0; i<len; i++){
if(gene.charAt(i) == 'C' || gene.charAt(i) == 'G')
CGCount++;
}//end for loop
System.out.println("CGCount " + CGCount + " Length: " + len + " Ratio: " + (float)CGCount/len);
return (float)CGCount/len;
}//end of calCGRatio() method;
public void printGenes(StorageResource sr){
//create a FindMultiGenesFile object FMG
FindMultiGenes5 FMG = new FindMultiGenes5();
//read a DNA sequence from file
String dna = FMG.readStrFromFile();
String geneList = FMG.storeAll(dna);
//store all genes into a document
StorageResource dnaStore = new StorageResource();
System.out.println("\n There are " + geneList.size() + " genes. ");
int longerthan60 = 0;
int CGGreaterthan35 = 0;
for(int i=0; i<geneList.size(); i++){
if(!dnaStore.contains(geneList.get(i)))
dnaStore.add(geneList.get(i));
if(geneList.get(i).length() > 60) longerthan60++;
if(FMG.calCGRatio(geneList.get(i)) > 0.35) CGGreaterthan35++;
}
System.out.println("dnaStore.size: " + dnaStore.size());
System.out.println("\n There are " + dnaStore.size() + " genes. ");
System.out.println("There are " + longerthan60 + " genes longer than 60.");
System.out.println("There are " + CGGreaterthan35 + " genes with CG ratio greater than 0.35.");
}//end main();
}

I found your post as I am also doing a similar course at Duke using those edu.duke libraries.
When I get that error message it is because I'm using the wrong method to access it.
Try FMD.data() to get an iterable of all of the gene strings.

return array from inside an if,for statement

I am building a tag reader for inventory purpose. Using the for loop to iterate through the tags to count/total the ids. I get an error on my return line "tagsFound cannot be resolved into a variable". How do i use the variable inside the for loop and then access it outside the loop?
public String[] getTags(AlienClass1Reader reader)throws AlienReaderException{
int coneCount = 0;
int drumCount = 0;
// Open a connection to the reader
reader.open();
// Ask the reader to read tags and print them
Tag tagList[] = reader.getTagList();
if (tagList == null) {
System.out.println("No Tags Found");
} else {
System.out.println("Tag(s) found: " + tagList.length);
for (int i=0; i<tagList.length; i++) {
Tag tag = tagList[i];
System.out.println("ID:" + tag.getTagID() +
", Discovered:" + tag.getDiscoverTime() +
", Last Seen:" + tag.getRenewTime() +
", Antenna:" + tag.getAntenna() +
", Reads:" + tag.getRenewCount()
);
//tagFound[i]= "" + tag.getTagID();
String phrase = tag.getTagID();
tagFound[i] = phrase;
String delims = "[ ]+";
String[] tokens = phrase.split(delims);
if (tokens[0].equals("0CCE") && tokens[3].equals("1001")){drumCount++;}
if (tokens[0].equals("0CCE") && tokens[3].equals("1004")){coneCount++;}
String[] tagsFound;
tagsFound[i] = tag.getTagID();
}
System.out.println("Cones= " + coneCount);
System.out.println("Drums= " + drumCount);
// Close the connection
reader.close();
return tagsFound;
}
}

public String[] getTags(AlienClass1Reader reader)throws AlienReaderException{
int coneCount = 0;
int drumCount = 0;
// Open a connection to the reader
reader.open();
// Ask the reader to read tags and print them
Tag tagList[] = reader.getTagList();
if (tagList == null) {
System.out.println("No Tags Found");
} else {
System.out.println("Tag(s) found: " + tagList.length);
String[] tagsFound = new String[tagList.length];
for (int i=0; i<tagList.length; i++) {
tagsFound = "";
Tag tag = tagList[i];
System.out.println("ID:" + tag.getTagID() +
", Discovered:" + tag.getDiscoverTime() +
", Last Seen:" + tag.getRenewTime() +
", Antenna:" + tag.getAntenna() +
", Reads:" + tag.getRenewCount()
);
//tagFound[i]= "" + tag.getTagID();
String phrase = tag.getTagID();
tagFound[i] = phrase;
String delims = "[ ]+";
String[] tokens = phrase.split(delims);
if (tokens[0].equals("0CCE") && tokens[3].equals("1001")){drumCount++;}
if (tokens[0].equals("0CCE") && tokens[3].equals("1004")){coneCount++;}
tagsFound[i] = tag.getTagID();
}
System.out.println("Cones= " + coneCount);
System.out.println("Drums= " + drumCount);
// Close the connection
reader.close();
return tagsFound;
}
}
the returned array will have empty strings in the positions where the tag does not satisfy the criteria.

Split 2 string and join

I have 2 string which I want to join as per my requirements. Say I have
String sa = {"as,asd,asdf"};
String qw = {"12,123,1234"};
String[] separated = ItemSumm.split(",");
String[] separateds = Itemumm.split(",");
StringBuffer sb = new StringBuffer();
for (int i = 0; i < separateds.length; i++)
{
if (separated.length == i + 1)
{
sb.append(separated[i] + "(" + separateds[i] + ")");
} else
{
sb.append(separated[i] + "(" + separateds[i] + "),");
}
}
deleteListItem.list_summ.setText(sb.toString());
it gives as(12),asd(123),asdf(1234)
But problem is , it can be like
String sa = {"as,asdf"};
String qw = {"12,123,1234"};
So in this I want like
as(12),asdf(123),1234

Try this code :
String sa = {"as,asd"};
String qw = {"12,123,1234"};
String[] separated = ItemSumm.split(",");
String[] separateds = Itemumm.split(",");
StringBuffer sb = new StringBuffer();
for (int i = 0; i < separateds.length; i++) {
if (separated.length == i + 1) {
if(separated.length == i) {
sb.append(separateds[i] + "");
} else {
sb.append(separated[i] + "(" + separateds[i] + ")");
}
} else {
if(separated.length == i) {
sb.append("," + separateds[i]);
} else {
sb.append(separated[i] + "(" + separateds[i] + "),");
}
}
}
deleteListItem.list_summ.setText(sb.toString());
// Answer : as(12),asd(123),1234

String sa = {"as,asd,asdf"};
String qw = {"12,123,1234"};
String[] separated = ItemSumm.split(",");
String[] separateds = Itemumm.split(",");
StringBuffer sb = new StringBuffer();
// first loop through separated, starting with a comma
for (int i = 0; i < separated.length; i++) {
sb.append(",").append(separated[i]).append("(").append(separateds[i]).append(")"));
}
// append remaining items in separateds
for (int i = separated.length; i < separateds.length; i++) {
sb.append(",").append(separateds[i]);
}
deleteListItem.list_summ.setText(sb.toString().substring(1)); // remove starting comma

if the lenghts of the strings are the sa, do the join
if (separated.length == i + 1 && (separated[i].lenght == separateds[i].lenght))

KeyTyped event - not able to read the last char of a string

So I've been working on this password strength checker, and to provide visual feedback of the breakdown of points to the user as the password is being typed in, I use a KeyTyped event and then analyze the string and eventually start giving out points as the minimum length is reached. Here's what the a part of the analysis looks like :
if (in.matches("[a-z]+")){
lowerPenalty = -15;
}
if (in.matches("[0-9]+")){
numPenalty = -15;
}
for(int i=0;i<inLen;i++){
if ((in.charAt(i) + "").matches("[A-Z]")){
upperCounter++;
upperBonus = upperBonus + 4;
}
However, when I run the program, it doesn't consider the last character of the password typed in by the user, and thus the corresponding counter is not incremented. Here's the screenshot:
As you can see in the above screenshot, the numCounter in Number Bonus row is still at '1' instead of '2'. I've tried using KeyPressed event, though the problem still persists.
Please help.
As requested, here's the keyListener code:
input.addKeyListener(new KeyAdapter(){
#Override
public void keyTyped(KeyEvent e1){
if ((int)e1.getKeyChar() == 8){
count = -1;
baseScore = 0;
lenBonus = 0;
upperBonus = 0;
upperCounter = 0;
numBonus = 0;
numCounter = 0;
symBonus = 0;
symCounter = 0;
comBonus = 0;
lowerPenalty = 0;
numPenalty = 0;
comBonus = 0;
totalScore = 0;
input.setText("");
strength_lbl.setText("Enter a random password");
strength_lbl.setBackground(Color.LIGHT_GRAY);
}
count++;
Counter.setText(count+"");
analyzeStr(input.getText());
baseScore_txt.setText(baseScore+"" );
lowerPen_txt.setText(lowerPenalty+"");
numonlyPen_txt.setText(numPenalty+"");
upperBonus_txt.setText(upperBonus+" [" + (upperCounter) + "x4]");
numBonus_txt.setText(numBonus+" [" + numCounter + "x5]");
symBonus_txt.setText(symBonus+" [" + symCounter + "x5]");
comBonus_txt.setText(comBonus+"");
totalScore = baseScore + lenBonus + upperBonus + numBonus + symBonus + comBonus + lowerPenalty + numPenalty;
totalScore_txt.setText(totalScore+"");
if (totalScore>=1 && totalScore<50){
strength_lbl.setText("Weak!");
strength_lbl.setBackground(Color.red);
}
if (totalScore>=50 && totalScore<75){
strength_lbl.setText("Average!");
strength_lbl.setBackground(Color.orange);
}
if (totalScore>=75 && totalScore<100 ){
strength_lbl.setText("Strong!");
strength_lbl.setBackground(Color.cyan);
}
if (totalScore>=100){
strength_lbl.setText("Secure!");
strength_lbl.setBackground(Color.green);
}
}
});
As requested, here's the analyzeString method:
public void analyzeStr(String str){
String in = input.getText();
int inLen = input.getText().length();
if (count == 1){
strength_lbl.setBackground(Color.RED);
strength_lbl.setText("At least 8 characters please!");
}
if (input.getText().length()<8){
lengthBonus_txt.setText("0");
}
else{
lengthBonus_txt.setText(lenBonus +" [" + (count-8) + "x3]");
}
if (count==8){
baseScore = 50;
if (in.matches("[a-z]+")){
lowerPenalty = -15;
}
if (in.matches("[0-9]+")){
numPenalty = -15;
}
for(int i=0;i<inLen;i++){
if ((in.charAt(i) + "").matches("[A-Z]")){
upperCounter++;
upperBonus = upperBonus + 4;
}
if ((in.charAt(i) + "").matches("[0-9]")){
numCounter++;
numBonus = numBonus + 5;
}
if ((in.charAt(i) + "").matches("[!,#,#,$,%,^,&,*,?,_,~]")){
symCounter++;
symBonus = symBonus + 5;
}
}
}
if (count>8){
lenBonus = lenBonus + 3;
lengthBonus_txt.setText(lenBonus+" [" + (inLen-7) + "x3]");
if ((in.charAt(inLen-1) + "").matches("[A-Z]")){
upperCounter++;
upperBonus = upperBonus + 4;
}
if ((in.charAt(inLen-1) + "").matches("[0-9]")){
numCounter++;
numBonus = numBonus + 5;
}
if ((in.charAt(inLen-1) + "").matches("[!,#,#,$,%,^,&,*,?,_,~]")){
symCounter++;
symBonus = symBonus + 5;
}
}
if (count>=8){
if (in.matches("[A-Z][0-9][!,#,#,$,%,^,&,*,?,_,~]")){
comBonus = 25;
}
if (in.matches("[0-9][A-Z][!,#,#,$,%,^,&,*,?,_,~]")){
comBonus = 25;
}
if (in.matches("[!,#,#,$,%,^,&,*,?,_,~][0-9][A-Z]")){
comBonus = 25;
}
if (in.matches("[!,#,#,$,%,^,&,*,?,_,~][A-Z][0-9]")){
comBonus = 25;
}
if (in.matches("[!,#,#,$,%,^,&,*,?,_,~][A-Z][0-9]")){
comBonus = 25;
}
if (in.matches("[A-Z][!,#,#,$,%,^,&,*,?,_,~][0-9]")){
comBonus = 25;
}
if (in.matches("[0-9][!,#,#,$,%,^,&,*,?,_,~][A-Z]")){
comBonus = 25;
}
}
}

Sentence comparison with NLP

I used lingpipe for sentence detection but I don't have any idea if there is a better tool. As far as I have understood, there is no way to compare two sentences and see if they mean the same thing.
Is there anyother good source where I can have a pre-built method for comparing two sentences and see if they are similar?
My requirement is as below:
String sent1 = "Mary and Meera are my classmates.";
String sent2 = "Meera and Mary are my classmates.";
String sent3 = "I am in Meera and Mary's class.";
// several sentences will be formed and basically what I need to do is
// this
boolean bothAreEqual = compareOf(sent1, sent2);
sop(bothAreEqual); // should print true
boolean bothAreEqual = compareOf(sent2, sent3);
sop(bothAreEqual);// should print true

How to test if the meaning of two sentences are the same: this would be a too open-ended question.
However, there are methods for comparing two sentences and see if they are similar. There are many possible definition for similarity that can be tested with pre-built methods.
See for example http://en.wikipedia.org/wiki/Levenshtein_distance
Distance between
'Mary and Meera are my classmates.'
and 'Meera and Mary are my classmates.':
6
Distance between
'Mary and Meera are my classmates.'
and 'Alice and Bobe are not my classmates.':
14
Distance between
'Mary and Meera are my classmates.'
and 'Some totally different sentence.':
29
code:
public class LevenshteinDistance {
private static int minimum(int a, int b, int c) {
return Math.min(Math.min(a, b), c);
}
public static int computeDistance(CharSequence str1,
CharSequence str2) {
int[][] distance = new int[str1.length() + 1][str2.length() + 1];
for (int i = 0; i <= str1.length(); i++){
distance[i][0] = i;
}
for (int j = 0; j <= str2.length(); j++){
distance[0][j] = j;
}
for (int i = 1; i <= str1.length(); i++){
for (int j = 1; j <= str2.length(); j++){
distance[i][j] = minimum(
distance[i - 1][j] + 1,
distance[i][j - 1] + 1,
distance[i - 1][j - 1]
+ ((str1.charAt(i - 1) == str2.charAt(j - 1)) ? 0 : 1));
}
}
int result = distance[str1.length()][str2.length()];
//log.debug("distance:"+result);
return result;
}
public static void main(String[] args) {
String sent1="Mary and Meera are my classmates.";
String sent2="Meera and Mary are my classmates.";
String sent3="Alice and Bobe are not my classmates.";
String sent4="Some totally different sentence.";
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent2+"': \n"+computeDistance(sent1, sent2));
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent3+"': \n"+computeDistance(sent1, sent3));
System.out.println("Distance between \n'"+sent1+"' \nand '"+sent4+"': \n"+computeDistance(sent1, sent4));
}
}

Here is wat i have come up with. this is just a substitute till i get to the real thing but it might be of some help to people out there..
package com.examples;
import java.io.File;
import java.io.FileNotFoundException;
import java.io.IOException;
import java.util.ArrayList;
import java.util.List;
import com.aliasi.sentences.MedlineSentenceModel;
import com.aliasi.sentences.SentenceModel;
import com.aliasi.tokenizer.IndoEuropeanTokenizerFactory;
import com.aliasi.tokenizer.Tokenizer;
import com.aliasi.tokenizer.TokenizerFactory;
import com.aliasi.util.Files;
import com.sun.accessibility.internal.resources.accessibility;
public class SentenceWordAnalysisAndLevenshteinDistance {
private static int minimum(int a, int b, int c) {
return Math.min(Math.min(a, b), c);
}
public static int computeDistance(CharSequence str1, CharSequence str2) {
int[][] distance = new int[str1.length() + 1][str2.length() + 1];
for (int i = 0; i <= str1.length(); i++) {
distance[i][0] = i;
}
for (int j = 0; j <= str2.length(); j++) {
distance[0][j] = j;
}
for (int i = 1; i <= str1.length(); i++) {
for (int j = 1; j <= str2.length(); j++) {
distance[i][j] = minimum(
distance[i - 1][j] + 1,
distance[i][j - 1] + 1,
distance[i - 1][j - 1]
+ ((str1.charAt(i - 1) == str2.charAt(j - 1)) ? 0
: 1));
}
}
int result = distance[str1.length()][str2.length()];
return result;
}
static final TokenizerFactory TOKENIZER_FACTORY = IndoEuropeanTokenizerFactory.INSTANCE;
static final SentenceModel SENTENCE_MODEL = new MedlineSentenceModel();
public static void main(String[] args) {
try {
ArrayList<String> sentences = null;
sentences = new ArrayList<String>();
// Reading from text file
// sentences = readSentencesInFile("D:\\sam.txt");
// Giving sentences
// ArrayList<String> sentences = new ArrayList<String>();
sentences.add("Mary and Meera are my classmates.");
sentences.add("Mary and Meera are my classmates.");
sentences.add("Meera and Mary are my classmates.");
sentences.add("Alice and Bobe are not my classmates.");
sentences.add("Some totally different sentence.");
// Self-implemented
wordAnalyser(sentences);
// Internet referred
// levenshteinDistance(sentences);
} catch (Exception e) {
// TODO: handle exception
e.printStackTrace();
}
}
private static ArrayList<String> readSentencesInFile(String path) {
ArrayList<String> sentencesList = new ArrayList<String>();
try {
System.out.println("Reading file from : " + path);
File file = new File(path);
String text = Files.readFromFile(file, "ISO-8859-1");
System.out.println("INPUT TEXT: ");
System.out.println(text);
List<String> tokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(
text.toCharArray(), 0, text.length());
tokenizer.tokenize(tokenList, whiteList);
System.out.println(tokenList.size() + " TOKENS");
System.out.println(whiteList.size() + " WHITESPACES");
String[] tokens = new String[tokenList.size()];
String[] whites = new String[whiteList.size()];
tokenList.toArray(tokens);
whiteList.toArray(whites);
int[] sentenceBoundaries = SENTENCE_MODEL.boundaryIndices(tokens,
whites);
System.out.println(sentenceBoundaries.length
+ " SENTENCE END TOKEN OFFSETS");
if (sentenceBoundaries.length < 1) {
System.out.println("No sentence boundaries found.");
return new ArrayList<String>();
}
int sentStartTok = 0;
int sentEndTok = 0;
for (int i = 0; i < sentenceBoundaries.length; ++i) {
sentEndTok = sentenceBoundaries[i];
System.out.println("SENTENCE " + (i + 1) + ": ");
StringBuffer sentenceString = new StringBuffer();
for (int j = sentStartTok; j <= sentEndTok; j++) {
sentenceString.append(tokens[j] + whites[j + 1]);
}
System.out.println(sentenceString.toString());
sentencesList.add(sentenceString.toString());
sentStartTok = sentEndTok + 1;
}
} catch (IOException e) {
// TODO: handle exception
e.printStackTrace();
}
return sentencesList;
}
private static void levenshteinDistance(ArrayList<String> sentences) {
System.out.println("\nLevenshteinDistance");
for (int i = 0; i < sentences.size(); i++) {
System.out.println("Distance between \n'" + sentences.get(0)
+ "' \nand '" + sentences.get(i) + "': \n"
+ computeDistance(sentences.get(0),
sentences.get(i)));
}
}
private static void wordAnalyser(ArrayList<String> sentences) {
System.out.println("No.of Sentences : " + sentences.size());
List<String> stopWordsList = getStopWords();
List<String> tokenList = new ArrayList<String>();
ArrayList<List<String>> filteredSentences = new ArrayList<List<String>>();
for (int i = 0; i < sentences.size(); i++) {
tokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(sentences.get(i)
.toCharArray(), 0, sentences.get(i).length());
tokenizer.tokenize(tokenList, whiteList);
System.out.print("Sentence " + (i + 1) + ": " + tokenList.size()
+ " TOKENS, ");
System.out.println(whiteList.size() + " WHITESPACES");
filteredSentences.add(filterStopWords(tokenList, stopWordsList));
}
for (int i = 0; i < sentences.size(); i++) {
System.out.println("\n" + (i + 1) + ". Comparing\n '"
+ sentences.get(0) + "' \nwith\n '" +
sentences.get(i)
+ "' : \n");
System.out.println(filteredSentences.get(0) + "\n and \n"
+ filteredSentences.get(i));
System.out.println("Percentage of similarity: "
+ calculateSimilarity(filteredSentences.get(0),
filteredSentences.get(i))
+ "%");
}
}
private static double calculateSimilarity(List<String> list1,
List<String> list2) {
int length1 = list1.size();
int length2 = list2.size();
int count1 = 0;
int count2 = 0;
double result1 = 0.0;
double result2 = 0.0;
int least, highest;
if (length2 > length1) {
least = length1;
highest = length2;
} else {
least = length2;
highest = length1;
}
// computing result1
for (String string1 : list1) {
if (list2.contains(string1))
count1++;
}
result1 = (count1 * 100) / length1;
// computing result2
for (String string2 : list2) {
if (list1.contains(string2))
count2++;
}
result2 = (count2 * 100) / length2;
double avg = (result1 + result2) / 2;
return avg;
}
private static List<String> getStopWords() {
String stopWordsString = ".,a,able,about,across,after,all,almost,also,am,among,an,and,any,are,as,at,be,because,been,but,by,can,cannot,could,dear,did,do,does,either,else,ever,every,for,from,get,got,had,has,have,he,her,hers,him,his,how,however,i,if,in,into,is,it,its,just,least,let,like,likely,may,me,might,most,must,my,neither,no,nor,not,of,off,often,on,only,or,other,our,own,rather,said,say,says,she,should,since,so,some,than,that,the,their,them,then,there,these,they,this,tis,to,too,twas,us,wants,was,we,were,what,when,where,which,while,who,whom,why,will,with,would,yet,you,your";
List<String> stopWordsList = new ArrayList<String>();
List<String> stopWordTokenList = new ArrayList<String>();
List<String> whiteList = new ArrayList<String>();
Tokenizer tokenizer = TOKENIZER_FACTORY.tokenizer(
stopWordsString.toCharArray(), 0, stopWordsString.length());
tokenizer.tokenize(stopWordTokenList, whiteList);
for (int i = 0; i < stopWordTokenList.size(); i++) {
// System.out.println((i + 1) + ":" + tokenList.get(i));
if (!stopWordTokenList.get(i).equals(",")) {
stopWordsList.add(stopWordTokenList.get(i));
}
}
System.out.println("No.of stop words: " + stopWordsList.size());
return stopWordsList;
}
private static List<String> filterStopWords(List<String> tokenList,
List<String> stopWordsList) {
List<String> filteredSentenceWords = new ArrayList<String>();
for (String sentenceToken : tokenList) {
if (!stopWordsList.contains(sentenceToken)) {
filteredSentenceWords.add(sentenceToken);
}
}
return filteredSentenceWords;
}
}

Develop Reference

Java is a programming language and computing platform first released by Sun Microsystems in 1995.

Replace characters with substring using a loop Java - java

Replace array2[x] = array2[x] + 1; array3[x] = "(" + array2[x] + ")"; with Integer n = Integer.parseInt(array2[x]) + 1; array3[x] = "(" + n.toString() + ")";

Related

Error message for StorageResource type

return array from inside an if,for statement

Split 2 string and join

KeyTyped event - not able to read the last char of a string

Sentence comparison with NLP

Categories

Resources